GenePrediction:GLEAN_5889 Details

Name: GLEAN_5889
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:322488..320519 (- strand)
Length: 1970
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:322488..322303 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_173:322245..322018 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_173:321931..321841 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_173:321792..320519 (- strand)
Length: 1274
>GLEAN_5889 class=GenePrediction position=GCSC_173:322488..320519 (- strand)
ATGGCCCACCACCATACCACTGCAGATACTGGCGTGCTATCACAGACGCTGTCTCGCCGCAGCGTGGCAGCCAACCTTGC
TGTGACAGACGATGATGAGTCTGTTTACAGCACCGACAAGCTGCCCTACTCCAAGTGGCGCTGCATCGCCCTCGTGGCCA
CTGTGACTGGCGCTAGCTTTTCTAATGTAGGGTCCAGTCCAGTTGGCACGACCTCTGCTCGATGCTGACACTGCTCGCAC
TAGACACTCTCGAGCCAGGCTGTCGTCATCATTCTACCGACCATCGGAAGCGACCTCGGCATCCCGTACAGCCGCCAGCA
GTGGATCGTCTCGGCGTACTCGCTGACCTTTGGCTGCTTTTTGCTGCTGTGGGGACGCATCGGTGATGTCTTTGACAAGA
AGACCGTCTTCCTCGCCGGTTCGGTCTGGGTTACAGCCATGACCGTGGCCAATCCTTTTGTCCGTAACGAGGTCGTCTTC
GATCTATTCCGTGGACTTCACGGACTGTCTGTCACATCTCTTTCCTCTGTTCTGTCTTTCCTAGCTGACCATCATAGGGA
GCTGCTGCTAATGTGCCCACTGCCATTGGCATTCTTGGCACAACCTTCCCACCCGGCAAGGCGAAGAACTATGCGTTCGC
AGCATATGGTTAGTCCCCTTCTGATTTCGACGCATATTGCATTCTAACCGCTCCAGGTGCCGGTGCACCCTTGGGCAGCA
TATTTGGCAATCTCATCGGCGGCCTCATCACCTCGTATGTCGACTGGAAATGGGTCTTTGGTGTATTGGCCATCATGGTG
GCCGTTATTACCGTAGCCGGCTTCCTCATCATTCCGTCTCACCCTCCACTTCAGCCAGCATCTGCAAACAGTGCGGAATT
GGATGCAGTCCCAGCCAAAGCAGCCCTTGCGAGCATTGACTGGGTCGGCGCCCTGATTATCACGCTGGGACTGGTGGGCC
TTTTGTTCGCGCTGACGGAAGAAAATGTGGTCGGCTGGTCGACGCCATGGGTCGGCGTGATCATTGGCCTGTCGGTGCTG
CTGATGGTGGTCTTTGTGTTCTGGCAGCTGTGGCTGGAGCGACCGCACAACGGCCAAGGTCGACGGGCCGGTCAGATCTG
GCCGCCACCACCGTTGGTGCGCATGTCCATCTTTACCAAGTCACACGAGAGCGGCGGCTCGTCATCGCTGTTTGTGGCAG
CACTGGTGATCATGGCCTTCTTTTTCAGCTCGTTCAACGGCTTTCTCGTCTACGCGACCTACTTCTTCCAAGACTACCAG
GACCTTAGCGCAATCCAGACGACACTGCGCTTCATCCCCACCGGTGTGGCCGGCCTGCTGACCTGCTTCGGCGTGGCCCA
GCTGCTCAGCCGCGTGCCCACCTATCTCTTGCTGCTCTTTGGAAACGCCTGCGTCGGCATCAGCAACCTGCTCATGGCCG
TGCCCATCCCGGCCGAGTCGACTTCCTACTTTGCCTACAGCTTTGAGGCCATGGTCATCTCGGTTCTCGGCGCCGACACG
GCCTGGCCCAGCCTCGCCCTCTTCGTCTCCCACGCCCTCCCGTCCGAGGACCAGGCCATGGGCGGTGCCCTCGTCAACGC
CGCCGGTCAGATCGGCCGTGCTATCGGCCTTGCTGTTGCGACCGCCATCCAGACCGCCGTCATGGCCTCTTCTCGTGGCC
GCTCTATCGTCGATGCCGGCCCCGTAAAGTCCCATGAACACGCCACCCTCATTGGCTTCCGTGCCGCCAACTGGTTCAAC
TTCGCCCTCAGCATCGCCGCCATTCTCGTCGTCCTCGTCGCCTTCCGTGGCTCTGGAATTGTCGGCAGGGTTCCCTCGAA
ACCGTCCGCCCGCCCGCTGCGTGCCTCTCACTGCAACTCGCCCTCGACTACAGCTAAATCATTGACAGACACGGAGATCG
GCGTAAAGAGCCCTATCCAGATCCAAGACGGCCATTTCGACGAGATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62