GenePrediction:GLEAN_588 Details

Name: GLEAN_588
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:780006..784986 (+ strand)
Length: 4981
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:780006..780136 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_97:782741..783307 (+ strand)
Length: 567
Type: CDS
Source: GLEAN
Position: GCSC_97:783373..783450 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_97:783512..784707 (+ strand)
Length: 1196
Type: CDS
Source: GLEAN
Position: GCSC_97:784766..784986 (+ strand)
Length: 221
>GLEAN_588 class=GenePrediction position=GCSC_97:780006..784986 (+ strand)
ATGAGCGCGGAAGCAGACAGACAGGCGCTGGGCCAGATCCAGATGAAGATGATCTGGCGATCAACGGCCGCCGACATCCT
TAGGCTGGGCCCGGCTGCGTTGGCTGCAAACCATCAACTCGAAGGCGGGTGGTATCTTAGGAAGAACAAAGGCCTGAAAG
ACATGAGGTTGGGCTGCTTTGATTTCATGCATGATGAGCTGGTCGCGTGGTTTAGGGCCACTCGTCCGTCGTGCCAGCCA
CTTTATCGCTTCATGCGCGCCAGCCGTAAGCGGCCTCGGTATCCTGCAGAGCCTACGACGTGCTGGAACTGGCACTGGCC
CTGGGACATGTCCTGGATTGGCAGCTGCCATTGCCGTTTTTTATCGCTGCGACTGCCCTTTTTTCCACCTTCCGTTATCG
TGTCGGGCGACCTGCCTTTCCACCCTGGCCGCCAATCCCTCACACATGGGCCGACCTGCATTCGAAACATGAATCACTCT
CTCCCTCGCCCAATTTCCTACATAGTACTATGTATCGATCCCTCTGTGCTCCCTCACGACCGACGGCGACTGCTTTGCGG
TGCCGCCACGATCGCGATTGGTACGGAGTGAAAGTATATCAGCAATGCTTGCTGGCAGAAACGAATTCGTATCTGAGCTT
GTATCTTACTAAGATACATAGTAAGATACGACGTACGGAAATACGATCACTCATGTAGCCGACCTGTGGCTGCTCCATAT
TTGGATGGATACCGCAGCTCACAATAGGCCTTCAGACGGCTGGACCCATAAAGGCGCCAATCGGCCGCCAAGAAACATAC
GAGCACAGAGCCATATTCGTATATCGCAGGCGCCGCTGCAATTTACGGATTGCCTTTGTGTGCGATTAAGCATATGACGG
GACTCTTTCTTGTCCTTGTTGGAAGTGCCTGACATTAGTCCGGACAATGACTTTGGTTGCTATAGCGGCCTGAAGGCGCA
ACCGCTTTTACAGCACATCCCAAAATTAGAGTGTATCACTTCCTCGACATCGGGCGCCGTGATTGGGCAACGAGAGATTG
CACATGTAGGCAAGTCTTCTGCATGGCCCTTTGGTTGGTGCGAAGCCAGAACAGAGGACATTGGAAATGAAAGCCCAAAA
CAAGACTACCGTGCAGCGAGGGATGTATCTTATCTACTCCGTAATTATTCGGAAGTTATGGTGCATTGGCAAGCGACATT
CGAGTAAGACAATTCCGCCTCCTCGCGTGGGATCCTGGGCCACATAAGGAAAGGTATCGCAACATGCTCGTATCTGCTCA
ATAACAATCGCGTTTGACCCCAAAGCGGCACCGTTTGCATGCTCATCGCCTGCGCCTCCTATCGTCGTCCTCCATCCATA
GCGTGAAGGCCCAACCGTGGCTGTGCAAGGTAGGCCGTGTGACGCGTACGACGAGAAGGGTGGCTTTTTATAGATTTTGC
TGTCCATTTGCTAGAGCCACACAGAACATCAGGCTCAACCAGCTGTCATCAAAGGTGATCCAATTCGGTGGTTTCTCATG
TACCTAACTCGGTAGAATATCTGACGTGTGCTTGGCGTTGATATTGCCTTATATGACCGGCTCTCCAGCACCGAAAAAGT
TGGCAGCCAAGCCCACAAAGCTGCAGATACTATCACGGAGTAGGCACGCTCGTATTTCACGTCAGATGCGGCGCCGGGAG
CGGCGCCTGTCAGAATTTCCGTATGTCCCATCACAGGCGTGCTCAGCCGTGCCGAGCAAGCAGAATGTGCCATGGGATTT
CTCCGCAGCAACCCACCCCATTCTGCATGCTCCATAATCCTACTATGTACGAAGAGGTCTCGTGAGCCACGCACGCTTTG
CTGCAGGTGCAACCCACCCCACCCCCAAAAAGGCTAAACCTGAGACTACGTCATCGCAAGGCCAGCAGCACGGCGGTACA
CAATCGGCCTTCCGACACGAAATAAGCTCTCGGGCTGCTGCTTATGCGGGCATACTCCGGACAGCTTGCTTGTAGGCCCA
ATCCGCCATATGCGAGCCCTGGTCAGCTGGCGGGAAGCCATGCCGAGACGAGCAGCCAACAGGGGGGGAAACAGGTAAAG
GGATGCTGTCAGCTCGGAAGCAGATAACGCGGAGCCAGGGACACAGTGCGCTGCCCCTTTTCACGTGCCGTATCCGTCGG
CTGTCGGCACTGTATACGCGTTTGTCGCTGCGATGGCCAGCTGCATGCCTGTGCACCGTGTACAGCGTACTGTAGCAGCT
GTCTCCCGCCAATTGTTTGTCTCTTTCTCCTTCCCTCTCCTCCATTACGCCGTACCTTGTTTTCGATCCCAACTTTTCTT
TGGCCTTTCTTCACCCTCCCGACTGTCCCGACTTGTCTCTGCCGAGCTTCCTCGGCCTCCTGCCATCGTCAGCCGACCTA
CCTCTGCATATCTGATCGCCATCACCATTGCATCGGGCACATCGACCGGAATAGCGCGTGCCTCCCTTTATATTGTATTA
TTTTTGTATAATTATTTATTTGTCAATTGACACACTGCAGAGACAACAGCTCCGACTGCCGGCACTATTCCCCACCCAAA
AAGACAGCCGAACCAGAGGACGAGGCCAACACATTTCGAGTCAGCGACCGGCTCATCCCGCCCTTTTCTTATCTTGAAGC
CATCTTCCTCTTCTTCGTTCTCCCCGCCCTTTCTTCCCCCTTCCCCCTTCTCCTTCTCTCTTCCCCAGTCGCGGACGGGT
GCTGCCGCCTTACAGCCCCCATCTCGTCAAGATTTCCTCCTTTACCAACCCGGGTCGTCTCCCGTCCAATATCCCACTTC
GTGACCTCCCGTCGTCTTCTGCACAGGCGTCGAGCTCTGCCGACCGTCAGGACAAACCGTTTCTTCTCGCCGCACCGCCC
GGCCGCCATCAGCGCCGCCGCCGAGCCGACTCCTTATCCTCGTTGGGTTCCCGATCCGATTCCGATTCCGATTCCGAATC
CTGGCTCGACACGGGCGACCTTGCCGAGCAGCTGGCTGACGACGCCGACAACCCTCCAGACATCCACGACCGTCGACATA
CCTCCACGGCCACAGCCGCCCCCTCTAGTCGCAAGAAAAAGCCGAGGCAGGTTCACTACGACGAGAGCTCGTCTCGAGAA
GGCTCCCCGCACCGTCATCTGCATCACCGCTCCGGCCACCATCACGCTGAAGACGTTGATAAAGAGGCCATCCAGATCCC
CGACTCGGCCTTCCGGCACGTCTCTGCGGCGGAACGCCTGCTTGCCTCCATCATGACGGGCGGCTCCTCATCCATCCATG
GCCTCACCGGCAAGCCCTTGATGTGAGAACGTCTGCTATCCTTGGCCAGCCAGGACGGTCTGCTAATCCAACCCACCTTG
TGCCCAGCTATTTCACCAGCATATTCGTCTCCTTGGGCGTCTTCTTGTTCGGATATGACCAGGGTGTCATGTCGGGCATC
ATCACGTATGAACCTACTATCCCTCAGGCCCATCCATCACAAGAAGAGTTTGTACTGACGGGACAGTGGCCCATACTTTA
TCGATTATTTTGGTCACCCCTCCAAGGCCCAGGTGGGCACCATGGTTGCCATCCTCGAGGTGGGCGCCTTCATCTCGTCC
CTCGTCGTCGGCCGTGTCGGCGATATCATCGGCCGGCGGAAGACGATCATGTACGGCTCGGCGATTTTCTTCACGGGCGG
TGGGCTTCAGACGTTTGCCACGGGCATGCCCATGATGCTGCTCGGGCGCATCATTGCCGGCTTGGGCGTGGGGATGCTGT
CGACCATCGTGCCCGTGTACCAGTCGGAGATCTCGCCGCCGCACAACCGTGGCAAGCTGGCGTGCATCGAGTTCTCGGGC
AACATCATTGGCTACACCAGCTCCGTGTGGGTGGACTACTTCTGCGGTTACATCAACAGCGACATGTCGTGGCGCGCGCC
ACTGTTCATGCAGTGCGTCATGGGCTTGCTCCTCGGGCTGGGCAGCCTGATCATCGTCGAGTCGCCCCGGTGGCTGCTCG
ACAACGACCACGACGAGGAAGGCATCGTCGTGATCGCCAACCTGTACGGCGGCGGCGACATCCACAACGCCAAGGCGCGC
GAGGAGTTCCGCGAGATCAAGATGGACGTGCTGTTGCAGCGCCAAGAGGGCGAGCGGACCTACAGCGACATGTTCCGCCG
CTACAAGAAGCGCGTTCTGATCGCCATGTCGGCCCAGGCCTTGGCTCAGCTCAACGGCATCAACGTCATCTCGTACTACG
CCCCCTACGTCTTTGAGTCAGCCGGCTGGCACGGCCACCAGGCCATCCTGATGACCGGCATCAACGGCATCACCTACTTC
CTCTCCACCATCCCGCCCTGGTACATTGTTGACCTCTGGGGCCGCCGTTTCATTCTCCTCAGCGGCGCCGTCGCCATGGC
CATCTCGCTCTCGGCCATCTCGTACTTCATCTTCCTCGACATCAGCGCCACGCCTACACTTGTCGTCATCTCCGTCATGA
TCTACAATGCCGCCTTTGGCTACTCCTGGGGTCCCATTCCCTGGCTGTACCCCCCGGAGATCCTTCCGCTGAGCATCCGC
TCCAAGGGCGCCAGCTTGTCCACGGCCACCAACTGGGCCTTCAACTGGCTTGTCGGTGAAATGACGCCCATTCTGCAGGA
GTGGATCAAGTGGCGCCTGTATCTTGTCCACGCCTTCTTCTGTGTCACGAGCTTTGTCGTCGGTAAGTGTCATTTCTCTC
CTCTTCAGACGAGAGCGTTTTCTGACAATGCCCCCTCTAGTGTACTTCTTGTACCCCGAAACCTGTGGCGTCCGGCTGGA
GGAGATGGGCTCTCTCTTTGGTGACGCCAGCACGGCCATCGGAACTCCCCAAGCGTTTGGGACACCCCGTGTTGGTGGCG
CTGAGGCTAATGCCCCTTTTTGGCCCCCGGCTCGCCCGTGCCTGGACTCGACATCCGTGGCCACAGTCAGTTTGGGCCTT
CGAGCGCAATACCAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62