GenePrediction:GLEAN_5890 Details

Name: GLEAN_5890
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:317209..316449 (- strand)
Length: 761
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:317209..317019 (- strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_173:316964..316731 (- strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_173:316677..316449 (- strand)
Length: 229
>GLEAN_5890 class=GenePrediction position=GCSC_173:317209..316449 (- strand)
ATGGATTCAATTGACGTGTATCCTAGATCTGACGAAGACAGATTCCTCTCTGTTCCATACGAAAGCCGATGGGAACCCCT
CAAGCGTGTCATCGTTGAGCTCTACATGGGAAAGTACGGTCCGGAGGGGAAGTCGATGACTATGCGCGAAGTTGCCGAGT
TCATGAAGGACAACTACTCATTTTATGCCGCGTAAGCTTATCCGATCGCTCGCAATACACCGTCACGACAATACTAACGG
CGCAGAGAAACGCAATACAAGCGTAAATTTCGACCCTGGTGCATTCGCAAGCGCACTCTTGCTACAGAGAAGAACGACAT
CGTGAGCGTCCTCGGCAAAAGGGCGCGTCCTGGGATGAGCACATCAGATGTGACACTCAGTCAAGGTGGTCTGGCCAAGT
CAGTCGACTCGAAGCAACTCAAGAGACATGTGCACAGCCAAATACGTCACTACAAAGTTGAGCCACTGGTTCCAGGAGTG
TAAGTTTTCAGCCAAAGGCACAAGTGGATACAAACTAACTTGACCAAACCAGTTTCACAACATTCAATATGCCCTACCAG
GCATACATCGCTGCCTCCAACCAAAATTCTAATTTGCCATCACCTGGCTTTGTAAACGTCCATAGTCCAGGGCCTGTTAC
AGCTCTGTCACCGACGATGCACCTGGTGAATCAAAAGGCTGTTTGGGATAGAGCAAACCTTCTGCTAAAAGGAGACTTCA
AGACACTTTTCGCGAGATGTGGAGACGAAGATCGCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62