GenePrediction:GLEAN_5899 Details

Name: GLEAN_5899
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:275245..272181 (- strand)
Length: 3065
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:275245..274901 (- strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_173:274816..273557 (- strand)
Length: 1260
Type: CDS
Source: GLEAN
Position: GCSC_173:273494..272181 (- strand)
Length: 1314
>GLEAN_5899 class=GenePrediction position=GCSC_173:275245..272181 (- strand)
ATGGACGCGACCTCGTCCAAGTCTCACAACCTCTTTCAGGTCTTCCTGCGGCTGCGTCCTCCCCAGGTGGGTGCGACGAC
GGCTGACCGGTTTCTCGATGTCGAGCCGCCCGCAACAGACGCCGCTTCCTCCTCGCCGACGCACATCCGCCTCAACCCGC
CCAACGACCGGCGACGCGCGATCGAGAAATTCGGGTTCACGCGCGTGTTTGAGGAGGACTCCACCCAGCTGGACGTTTTT
CACTGCACGGGTGTCGTACCGCTCGTCGAGGGCGTGCTGGCACCGCACGGCGGCGACGGCACCGACGCACTGCTGGCCAC
ATTAGGTGTCACTGGCTCCGGCAAGGTGAGAAGATAAAACCAGATGAGACAGAACAAGACAAGACGAAGGAACACAGCTC
TGACCCGGTCGTTCTCGTCCTCCTCACAGTCCCACACTATCCTTGGCTCTCGCTCGCAGCGCGGTCTCACACAACTCTCG
CTCGACGTTGTCTTTCGCTCTATCGGCGAGAACATTGTCGATTGCGCGGCTTCTCCGTTGCTGGAGACGTCAATCCATGC
ATCGGACGCATCAGAAGCGACCATCTTTAACGCCCCGGCCTTCCTAGACTCTGTGTACGGTGACAACACAGGGTCTTCTC
GTCCCAGCTCACGGGCCTCAACACCAATGCTTGTACGGCCTCTTTTCTTTTCGTCTGACATACCCACTTCGCCCTCATAT
CCAGAACACGGCTGCCATAAAAACGACAGCGGCAACAACAGAATCAGCAGCCTCAGTGGGCTGCCGATGCCCGGAAAGTT
CCCAGTCAGTCCCAGTGGGCAGCAACAAAAACTGCACAGCAGACTGGACAGTGTCCGGATCGTGCGTCGGGAGGACTATG
TGGTGGTGCCCGAGGAGACGGAGGACGCTCTTCTCCTCGAGCTCCGGATGCGACAGAGTAGTCGCCGTACCGTGGTCGCT
CCCAAGACGCCGTCCAGAAGCAACATACCGCGGCCGTTCATGGCCACCACGGCGTCGGCACAACAGAGAAGCACAAGCAA
TGCTAAACCATCATCTTCTTTACAGGGCGATCACTCGCATTCCGTGAACAGTAACGCGTCGACTGGATCGGCCCGCCGTC
TCCTGCTGCACCGGCCATCGGCCTTCCCGCAGCAGCCCGACGTCAGCGCCATTAACGTCAGCAGCGATCCGGCAGCGCAA
TATGTGGTGCTGATGTCGATGTACGAGGTATACAACGACCGCATCTTCGACCTGCTGACACCCGCAACTAAGGCTGCTGG
CAGCAAAGAATACCGGCGGCGGCCGCTGCTATTCAAGAGCACCGAGCTGTCGCCGGACCGCAAGGTGGTGGCTGGGCTGC
GGAAGATTGTGTGCAGCACCCTGCAGCAGGCTCTGATGGTGTTGGAGGCCGGTCTGCATGAACGGCGTGTGGCGGGTACG
GGCAGCAACAGCGTCAGCTCGCGCAGCCACGGCTTCGTCTGTGTCGAGGTGAAGAAACGCACCATCGGCAACGCAAACGC
ACCATGGAGCGGCAGCACGCTGACAGTGGTCGACCTGGCCGGCAGTGAGCGGGCGCGCGATGCCAAGACCGCTGGAGCAA
CACTTGCCGAGGCCGGGAAGATCAATGAGAGTCTGATGTATCTGGGACAGTGTCTGCAGATGCAGAGCGACGCTGGCAAT
TCCAGCAAGGTGAGTAAAGCGGCTGCGAAAAGACCAAGGAGAGATCAAGCCAAACCTGCTGACATAAGCAGCCAAATGTA
GTTCCGTTCCGGCAGTGCAAGCTGACAGAGCTGCTCTTTTCGAACTCGTTCCCGTCGGCGACGCAGCCGTCGACGCGGAG
AAACCCGCAAAGGGGAGTGATGGTCGTGACGGCCGACCCTCACGGCGACTACAACGCAACGTCACAGATCCTGCGGTACA
GCGCGCTGGCTCGCGAGATCACTGTGCCGCGCATTCCGTCCATAACACAGACAATCGTCTCCAACGGCAGCGCTGGGCCC
CAGACAGCAGCAGCAGCAGCAGCAGTGGCCAGCCAGGACCCGCGGTCTTACTCTCCGGCGATGCCGACGCCTCCGAGCAG
CCACATGCTGAACCATCAGAACCATCAGAACCCCCAGAATTCTCCGAATATTCAGATCCACAGCAACCAGCAGCGACAAG
GATTCGCACCGGGCACTGGGCCCCGAACGGGGACGCGGGCGTTCTCGCCAATGGGCGGTCCGGCTGTGGCCATGTCGGAT
GAGCGGGTGACAATGGAGATTGCGGCGCTGGAAATTGCGCGCATGGCCGAGGAGATGGACTACCTGCGAGCGCTGCTGGA
ACAGGAGACGGCGGGACGATTGGAAGCGGACGCGCACCTGCTGTCGGCGAAAGACCGGATGCTGGAGCTGGAGCAGGAGG
TCCGCGAAGACTGCGCAATCGAATATGAGCAGCGGCTGGCACTGGAGATGGCACGCTGGAAGGCGAGCCTGGAGGCAGAG
AAGGAGCGCAACGAGGCGCACTGGGACCGCAAGGTCGAGGTGATGGAGCGGCTGGCGAGTGCAGCCGATGAAGGTGGCGG
CTGTGACCACGACGACAAGGAGAACGTGCTGGTCGAGAACCTGGAGCAGGAGAATGAGCGGCTGCGGCGTGAGCTTCTGG
TGATGCGGCGTGAGCTGACGGCCCGGTCGCCCAGCAAGCGGCATCCGCTGCGAGAGCGCGACGACCTGCCGATAAGCATG
ACCACAACCACGACCACCAACTCCAGCAGCTCGTCTGCCACAGCCGCCGCCGTCTCGCTGTCCACCACGCCCACCGGCAC
GCCCTCGGGCACGCCTACCGGCACACCCTCGGCTGCTGATGAGCTCGGCCTGCGGCGCCGTATGGAGCAGCTGCGCGTCG
TCGACGACGGTGACCACCGTTTCGACCCCCGGCTCGACCGAGGCCGCAACGACCGCCACAACGATGCGTCGTCGGTGCGC
TCGACCAAAGTCGCGGCTGTAACCCGCAACGGCAGCCCCAAGAAGACTCGCAAAATGTCCCCACGCAAGTGGGACGTGGC
CCTGGACGAAGACGATCTGTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62