GenePrediction:GLEAN_589 Details

Name: GLEAN_589
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:785822..788529 (+ strand)
Length: 2708
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:785822..786144 (+ strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_97:786204..786284 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_97:787217..787509 (+ strand)
Length: 293
Type: CDS
Source: GLEAN
Position: GCSC_97:787574..787792 (+ strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_97:787855..788043 (+ strand)
Length: 189
Type: CDS
Source: GLEAN
Position: GCSC_97:788098..788250 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_97:788309..788529 (+ strand)
Length: 221
>GLEAN_589 class=GenePrediction position=GCSC_97:785822..788529 (+ strand)
ATGTCGAGCGCCGAGCTGGTGCAGGCTTACCGCAGCCTCTACCGCAGCGGTCTGCGCGCCGTGCAGTACTCGAAGCCGGC
GCGGTACGTGGTGCGCAACCAGCTGCGGGCGGCCTTCCGCGACAGCAAGGCCGGTCCGGGGGCGTTTGATGCCCGTGCCA
TCCGCAACACGGTCTACTTTCTCAACGCGGCGGCCGAGTCGCGCGAGCTGGAGCACCGGATCGTGCGCAACCTCGTGACG
ACGGCCTACTGGCGGGACCGGCGGGCGGCGCAGCAGCGGCCGTCGTGGAGCAACGTGGTGGCATCGAAGAAGGAAAAGCC
AGTGTGAGTGGTGTTTCTTTGTCTTCTTGTCTTCTGCTGCATGCTGACTTGGACACGACCAGTGACGAGATCGACCGGAC
GGCCTACGACCACTACGACCAGACGGTGAAGCAGCTCAACGCAACGATGAGGATGTGCCTTCGGTGAGAACACGAGAGAG
ATCAGCCGTGGAAGAATGCCCAAAGGCGACACGCAGTCTTGGCGAGCAGAGACATTGGGACGCCAGCCACATGCCGCACG
CCTCTGTATACGGGTGGGACAAGGGGCTCTGGCAACAAAGATGCCACGTGCGACCGGACATGGGCATAGGCTTTCTCTTT
CTCCTGTACTCCGTACACTCTGTACACAGATGTCTTAGTCAAGCTGGATCACGTGTGGAGGACAATATTCGACGTTTGTA
TGTAATGCAACCCAATGCACAGGTGTGGTGTGATTGAGGGGTTTGGGGGCAGCCAAAATGACGTCGGCTGCCGTGCAGAC
GAACCACGGCTTGGGAATGAGCTCAGGCAGAAGAGGGAAGCTGGCTGGCAAACGCGGGGAATGAAAAGGCGGCTCGACAA
GCTAGCAGAACGAGCTGCAGATACCACCCTTCCAGCTCTCGTGCTGCCATGATGTATTTATCTCTCTACCCGGTGTATGT
AGGAGACCTTGTGAGCAGTCAGCAAACGAGACAGCTGATTGATCTGCCCGGCCTCCCAGAGGAGGAGCCGTTCTTTCGCT
CTGCTGCGACACGGCGATTGTGTCGGCTAATGATACAGCTTGGATCCAAACAGCGCTGAGCAGCTGGCCCTGTCTCTCGT
TTGTGCAGATAGGACCCACTTTCGCCCCCACCAAAACCAGTCATTTTGCTCGCTTCTTCTGCCAGACAGCCGACAGACAG
ACCGACGTGAATGCAGTTCCGGCGGCGACAGCAGCACTTGCCGACGCGCACACGCCTCCCCGCCACCGCTCTGAGCCTGC
ACGCGCGCACCTTGAGCTGCCGACGCGTTGCCGAGCCGAGCTGAGCCGGACTTGATGGACCGTCTCCAGGCCGCTGACTG
CTGCGCGACTGCACCGAACCAACTACAACCGCAAGGGTCCAGAGGAACTCGCCACGGGCTCCGGCCTCTCGATCACGGAG
CATGCCGGCCGAGACTGATTCTGGTCGAGACGGTGCCGCGGTCGTGGCCCGGTCGCACGCCCATCCGAGGCGATGGGTGA
AGCGATACCGCACCGAGGTCAGCGCCAGCATGTCCAGCGTCCTGAGCACGGCCTGCGCCTTTCCGCTCGACAGCGTCAAG
ACGCGCATGCAGACGTACGGCTACGGCGGCTTCGTCGACTGCGTCCGGCGCACGTACCGCACCGAGGGCGTCGGCGGCTT
CTTTCGCGGTGGGCTGCCCCTTTTCCCTCTTCTCTGTCGCGGCGAGGCTGACAGGCGTGGCGAGCATCGCAGGCGTGACC
GCGCCCATGGCCAGCGTCACGATCGTGCGGACCATCTCCTTTTCCATCTACCAGCGCGCCAAGTATGTGTATGGCGACTG
GATCCGGCGGAATGTCGGCTACGACGTCCACGGCCACGTCAGCCAGGCCGGCTCCTATCCCAGCCTGTGGACCGTGGCCT
GCTTTGGGGCGGCGGGAGCGACGGCCGGCTCCTGCATCACGGCCATTGCCTGTAGGTCGTGTCGGTCCTCGTGGCAACAG
CTTGCTCGGTCGCTGACAAGCCGTGACGAACAGGCCCCTTTGAGCTGACGAAGCTCAGCGCGCAGATCTCGGTCCTGATG
TCGGAAAAGGCGCAGTGCCCCGACCCCAAGTCCTACGCGGTGGCCTCGAGCTACCAGAACAAGGGCACGCTGAAGACCAT
GGCCAACATTGTGCGCCACCGCGGCTTGAGCGGCCTGTATACCGGCTTCCGGCTACACCTCTGTTCGTCTGCTCCCCGCC
CTGGTGGGGTGCGTGATCGCTAACACAAACCAACAGTGAGGGACACGCTGGGGACCGGACTGTACTTTATGACGTACGAG
AGCAGCAAGCAGCTGATGACGACCGTTGTGGGCGATGCCTCACCTTCGAACCCGGTGTCCGTCTTCGTGGCCGGCGGCCT
CTGCGGGGTCGTGTCGTGGGCTTTGATCTGTGAGTCTGGTTGCCTGGGACAAACGCGGCGCTGCTCCCACGCTGACCTGT
CTGACAGATCCGATCGATTCGGCCAAGAGCATCTACCAGCGCAACGCCCTAATGCACGCGAAAGGCGAACACATCGAGCC
GGCCAAAGTGAGCTTCTTCCGGAAAAACATGTACCGTGGGCTTGGCGTATCGATGACTCGGTCTTGCTTGGTGAATGCCA
TCTTTTTCTCGGCCTTTGAGTTCTGGAAGAAGCATATTGATGCGTTGGAGGACCATGCAGGGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62