GenePrediction:GLEAN_58 Details

Name: GLEAN_58
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:397047..399186 (+ strand)
Length: 2140
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:397047..397181 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_179:397253..398123 (+ strand)
Length: 871
Type: CDS
Source: GLEAN
Position: GCSC_179:398180..399186 (+ strand)
Length: 1007
>GLEAN_58 class=GenePrediction position=GCSC_179:397047..399186 (+ strand)
ATGGTTTTACCAAAGTCCAAGACCTCTGTTGGTCTGGGCAACACGTTGATGAAAGATCGCTTTGGCAAGGGAAAAGGAGC
GGACAGACGCAAGGGCGCCTCTATTACGCGGACAGATCATGTGACTGGCGAGCAGGTACGCAGACGAATGCGACGACTTA
TAAGACAGTTTCAGACCAAACGTCCGCTGACATTATGACGTTCCAGTATGTGACTACTGCGCGCCGCGAGGCCGGATGGG
TGAAGATGCGCTCCGTGACGGAACAGGGCGCGTTGGAGGAGTTCTTGGCGACGGCGCAGTTGGCTGGCACCGACTTCACG
GCACAGAAGATGAACAATGTCAAGATTATCCACACGGACCAGAAGAACCCGTATCTTCTGACGGCGGCAGAGGAACGGAC
AGCGCTGAAGAAGCACAAGGAGAACAGAGACCGGCTGACGGTGCCGAGGCGTCCGAAATGGGATGCCTCAACGACGCCGG
GGGAGCTGGACCTGATGGAGCGCGAGTCCTTTTTGGTGTGGCGCCGAGGACTTGCCGAGCTGCAGGAGAACCAGGATCTG
CTGATGACTCCGTTTGAGCGGAATCTCGAGGTCTGGCGGCAGCTGTGGCGAGTGATTGAGCGCTCGGACCTGGTGGTGCA
GATTGTCGACGCACGCAGTCCCTTGCTGTTCCGGTCCGAAGACCTGGAGGATTACGTCAAGGAGATCGACCCGCGCAAGG
AGAACCTGCTGTTGATCAACAAGGCCGACATGATGACGGAAGAGCAGAGATTGGCCTGGGCCACGTACTTGAAGAAGGCC
AATGTGTCTTATAAGTTTTTCTCGGCATATCTGGCCAAGGAGCTGAACGAGCAGCGCGAGTTCGAGAGCAGCGACGAGGA
AGGGTCCGAGGACGAGTCTGAGGACGAGACGGAAAGAGTTGCTGGCGGTGCAGCCATTGCTCCCAAAGAGGAGGCGACAA
AAGGAGAGGTGACAGATGTCAGCAATGATGCGAACGAGGACGAGCCGGACACACACATTCTCACAGTAGAGGAGCTTGAA
GAGCTCTTCCTGAGCTTCCAGCCAAAGGATGACAGCAGTGAGTTTAGTCTTTGTCTGACCTTTAGCCCGACACGGTGCTG
ACGGTGTGCATAGATTCCGACCGGAGACTGCAAGTCGGTCTTGTCGGCTACCCCAACGTGGGCAAGTCGTCGACGATCAA
CGCCCTGATCGGCGCGAAAAAGGTGTCGGTGTCGTCGACGCCGGGAAAGACGAAGCACTTCCAGACGATCCACCTGAGCG
AGAAGGTGATCCTGTGTGACTGTCCCGGATTGGTGTTTGCCAACTTTGCGACGACCAAGGCAGATCTGGTGTGCAACGGC
GTGCTGCCGATCGACCAGCTGCGCGAGTTCACGGGGCCGGCAGCACTGGTGGCGCACCGGATACCGCTGCCCTTTCTCGA
GGCCGTATACGGCATGCACATCCGGCTGCGGCCGCTGGAAGAGGGTGGCACGGGCATGCCGACGGCGGAGGAGCTGCTGA
TGGCGTATGCACGAGCACGCGGCTTCACCAAGGCCGGCCAGGGCCAGCCGGACGAGTCGCGAGCGGCGCGCTACATCCTC
AAGGACTACGTCAACGGCAAGCTGCTGTACTGCGCGCCACCACCGGGTGACTACGACCCGGTCGAGTTCAACCGCGGACT
CTACGACGTGGCACATCTGCCGGAAAAGCGGCGAGTAGCACTGGGGGCGGCGAAGGCGACGGGCGCGATGCAAGGCATGT
CCCTGGCCGAGGACGAGGCGAACAGCGGGAGCGAGGACGACGGCGAGACGGAGGTGGCCAGCGACATGATCGCGCTTCCG
GTCGGCCCCAAGACGCAGAAGCTGGACAAGGAGTTTTTCAAGCCGCAGCGCGGAACAGCCGGCCACATGGACATGCCTTT
CAGCCACAAGTACTCGGAGCAGGGCCAGGCGGCGGGCAAGCAGCTCAGCGGGCGCAAGGCGCGGCTGATGGTGGCGCTGG
AGAACGGACTCGACCCGAGCGAGGTCCGGGCTCTGTCTGGCAAGAAGCACTTCAAGGCCGGCAAGAAGGCCAAGGGCAAG
AAGAAGATTGGCGTCGGCCTGGAGGAGGAGGTACGCGGTGGCGGCCACGCGCAGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62