GenePrediction:GLEAN_5900 Details

Name: GLEAN_5900
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:257010..255875 (- strand)
Length: 1136
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:257010..256903 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_173:256843..256185 (- strand)
Length: 659
Type: CDS
Source: GLEAN
Position: GCSC_173:256124..255875 (- strand)
Length: 250
>GLEAN_5900 class=GenePrediction position=GCSC_173:257010..255875 (- strand)
ATGGGCTGGTTCTGGGCAGACACGACGGCGACGGCAGTACCGGCAGTGCCGACAGGAAACCGGCAAGCCTGTCCGCATCC
CCAGCAGCCACTGAACAAGCCTCCTCCGGTATGCGGCTCCGTTCGAGGATTTGGGGCACATGGGGAGCTGCTAGCTAACT
CTCCTAGCCTGGCTGTCCGATGCACAATGCGACGGTCGATGCGCTGAGCCTGCACAAGATCGGTGTGCCAGCGGCCGGTG
GCGTCGCTTCTTCGTCGAGCCCGTCCTCCTCGGGCTGTCCGGTGCCGCACGCACAGCGGAATGGCAGCCAAGCGGAAGCA
TCATTGCCAACACCGCCCCCGTCGGCCCTCTCGCGGCTCAATCCGCTCAACTTCATGTTCCGCGAGCTGTCGCAGGAGCG
TGCCCCGGAGCAGACGGTGGCGCTACCGACATCGCGCGAGGCGTCGACGATTCCGCGCGGCGACGGCGACGGCAACTGGG
AGTATCCGTCGCCGCAGCAGATGTACAATGCGCTGCTGCGCAAGGGCTACACCGACACGGATGCCACGGCTGTCGAGAGC
ATGGTGGCCGTGCACAACTTCCTCAACGAGGGCGCCTGGGCCGAGATCGTCGACTGGGAGCGTCGCTTCGGTCATGGTCT
GGCACGCGGCTGGCAGATCAGCCGCCGAGGCGAGGAGAACGCGCCAGACGTGACGGCTGCCCTCGAGCGTGTCGGCGGCG
CTGTCGAGCCACCTCGTCTGATTCGCTTCCAGGGCCGTCCGGGCGACATGACCCCCAAGGCCGCCTTTGTCCAGCTGCTC
GGGAGGCTGTACCCGGCCAAGTATGGGTGAGTTCTTCTTTCTTGGCACCTGGCATCTCTCTGTCTCTGAGCTCCTAACAC
CCGTAGCACCGAACCTCCGTTTGATCGCCACGATTGGTACGTCGCCCGCAACGTCAACGGCCACGAGAAGCAGATTCGCT
ACGTCATCGACTTCTACTCTGGCCCGCCAGAGCCCACCGGCGAGCCCGTCTTCTACCTCGACGTCCGGCCTGCTGTCACG
CCCTCCGCCGCCGTCGAACGGCTGATGCGCTGGGGCGGCGACGTCTGGTGGCGTGCCTCGGGCGGCGAGGCCCGCGAGCC
CTGGAACAAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62