GenePrediction:GLEAN_5906 Details

Name: GLEAN_5906
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:223072..221257 (- strand)
Length: 1816
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:223072..222813 (- strand)
Length: 260
Type: CDS
Source: GLEAN
Position: GCSC_173:222645..221574 (- strand)
Length: 1072
Type: CDS
Source: GLEAN
Position: GCSC_173:221406..221257 (- strand)
Length: 150
>GLEAN_5906 class=GenePrediction position=GCSC_173:223072..221257 (- strand)
ATGCTTCCCTCCGCCTGCCATGAGGCCGACTCCGTCTACGAGATCCAGCCGGGCACATTGCTGCAGCTGTTGGCCAACGC
GGTCGTGCTGGGACACACGACACCCTACCTGCCACCATCGGCGCTGCTAAGCCTGGCCGCCACCAGCCGGGCCTACCGCG
CCCTGCTCTACGGCACGCCCTCGGTCTTTGGCCGTCTGGACCTGTCGGCCATCGGGCTGGCCGCCGTGCCGATCAGCTCG
CTCGACCGCAGCGGTGAGTCGTGGCGTCGGGCCCAGCTGGGCGAGACTTGGCGAGGACAGCTGGACGAGAACCTGACCGA
GGATGAGTGTTTGTTTTTTTTTTTTTTTTTCTTTTTTTCTTTTTTTTTTTCTTTTTTTTTCTTTCCTTCTTTCTTATTAC
CTTTTTCTTTCCCTTTCTGACTGCCAGATTCTACTCCGGTCCGCTTCGCGGCGTCTTCAGTGCGCTCGGCCGCGCTGGCT
GGCTGGCTGGCGTGCACACGCTCCTCCTCGACCGTGTCGCTGTCACGGCCGAGCTCGTGCACGAGATCATCACCAGTCCG
GCCTACAACGTGCGGATCCTGTCGCTGCGCCATGCCCGCCACCTCGACGAGCACCGGCTGCGCCGCGTGCTGAGTCTGGC
CTGTCGGCCAGGTCGACCGGCCGGCATGCCCCGACTGCGCGGGCTCTACATCATTGGGGGGGATGAGACGGAAGACCAAA
AGGAAGACCAAGATCGGACGGACGACGGCGACCTGTGGTATCGACGTCGCGGCCGCGTGCTGTCCGGCAGCGCGGCCGTC
CAGGCTGCTTCGTGGGCCAGCACGCTGATGGACTGTCGCGGCGTCCTCGCCTTTGATGCGGTCCTCTGTCATGGGCCTCG
TCACGTGACATCACCAGGTCCCCCCGCCATCGCCGCCCACGCCCTCGATGGCTGTGCCGGCTGCGGCAGCGCGCCCGAGG
GCTGGACCGCCTGGGGCGACGAGAGTGAGCGGACCGACGTGGCCGGCTATGTGTCGCGCTACCCGCTGCTGTGGCCGCCG
CCACGGCTGTCCAGCAGCATCCGCGCGGCCATGTGTCCGGAAGGCGAGCCGGTGCATCCGCTGCGCCATCGACTGCGGCC
GGCCAGCCCGGCTCGCTTCATCGCCCGCTGTGACGCCTGCATCCACGACCGCATGTGCTTCACCTGCCGCCGCTGGTGGT
GCGAGTCGTGCATGCCGGATCAGATCGGGGGTCCATCGTCCAAGGTTGGTCCGGATTGGATATCCTCTTCCGAACACCCA
GACACTTGTCCTGCTGACCATGCCAGACTCCTTCCATTGCATATAGCTGTCGTGAATGCGGCCCCAGCGTACGTCCTGCC
CAAAGTGTTCCCGTTCTCGAACGGACGGCCGACTTACTACTCCCAGTGCCACGAATGCATCGCCGAGACCCAGCTCTGGT
GCAGACGCTGCCGTACTGGCTATTGCACCGTCCACAATGTCGGGTCCAGCCCAACCCACGTATGTTTTGGCTTTTCCCTC
TTCTTCTCCTCTTCTTCTCTTGCTGACTGCCAGTGTGACTGTTTGTGCATTCCCTCCGCTCGCTCCTCTTCGTCGTCGAG
TTTGTGTTGACAACGGCCCGGCCGATTAAAACAGGGTGTTGTGCACCGTCTTATCGCTACGCCCAGGTAAGAAACACTGC
CCTTGTAGCTGTTCCGGAAGCCGCCGTCTGGATGGCCCGGTTTTCTCCCGTCTTCCGCTTCTATTCTGAAGAGGCTAACC
GAGGTTATATTATGGACCAACAGCAGCCACGTGTGTCTCTCAAGAGCCACTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62