GenePrediction:GLEAN_5907 Details

Name: GLEAN_5907
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:219389..217938 (- strand)
Length: 1452
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:219389..217938 (- strand)
Length: 1452
>GLEAN_5907 class=GenePrediction position=GCSC_173:219389..217938 (- strand)
ATGGACGACTCTCAGGCCGTCGTGTCGTCCCAGGACGCCGAGGTGCCGGTCGCCGACCGTGTCGACGGTCCCAGCCTCCT
CGACCATGTCTCCCGTCTCCACCCCCTCAAGCTCAACCCCCTCAAGCTCAACCCCCTCCAGCTCCACCCCCTCGACCCGC
CACGACCGCCTCTCCGGCCGCTCGCCGAGGTCATGCCCCCTCTGCTGCTCGGCACGGCCACCTTCAACACCCAGTACGTG
GCCGACCCGGCCCAGATGCCGTACCGTGCCATCGTGCGCCGCGCCCTGGTCGATCTGGACGTGCGCGGCTTCGACACGTC
GCCGTACTACGGGCCATCCGAGGCGCTGCTGGGCGAGGCTCTAGAGGCGGCGACGGACTCTTCAACGGTCCCGCGGTCCT
CCTACTTCCTCGAGACCAAGGCCGGCCGCGTCCACAGCGCCGGCTTCGACTACACACCGGCAGCCGTGCAGGCCAGCGTG
CGCCGGTCGCTCCAGCGCTTGCGCACGTCCTATGTCGATCTGGTATATGCGCACGACGTCGAGTTCGTGACGGCGGCCGA
GGTCGTGGCAGCAGTGCGAGCACTGCGGGCGATGCGAACGGACGGAAGCGAGAAAGGGGCTCTCCGCTATGTCGGCATCT
CCGGCTACCCGGTCGATGTGCTGGCCGGACTGGCCGAACAGATCCTGCACGAGACCGGTGAGCCGATCGATGCGGTGCTC
AGCTATGGGCATTGCACCGTGCAGAACGAGCAGCTGTTGCGGAAGTTGCCGGTGGCCGTTTCCGGTTCTTCCGTTTCCAC
CGTTTCCACCGTTTCCACCGTTTCCACCGTTTCCACTTCCACTTCCACTTCCCCCCTCTCTCGATTTCACGCCGCCGGCG
TCTCCGTCGTCCTCAACGCCAGCCTCCTCAACATGGGCCTTCTCACGACTCGTGGTGTCGCCTCTGGTCCCCTTGCTGCC
TGGCATCCCTCGCCGCCTGGCCTCCGACTCGCTTGCCAGCAGGCCGCCGCCGTCTGTCGCCAGCAGCTCGGCCTCAGTCT
CGAGCACGTGGCCCTGCGATATGCACTCGATCTCTGGGCACGAACTGCTGCTGATGCCGGACTCGGGACCAAGGCCGTTG
GACAAGACCCTAACACCTCTTCTTCCACCTCCACCCCCTCCATCGGCCCCTCTGTTCTTGGCGTAACCTCCGTCGACGAA
CTCACCGAGACCGTCCTTGAGTGGTGGAGCGTTCTCGACCGTCTCGGCATCCCCCATCGATCCGTTCCTGAAGACGACAC
CATCGCTACTACCACTACCACTACCACCACCACTTCTGACCCCCTCAACATCACCGCCTTCGTCCACGACCACCTTTGGC
CCGTCCTCGGCACCTGGAAGGACTATGCCTGGCAGAGTCCTCCTGCCGACTGGACCAACCAGCTCACTTCCCAAGACGCT
CCAACCCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62