GenePrediction:GLEAN_590 Details

Name: GLEAN_590
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:793593..794651 (+ strand)
Length: 1059
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:793593..794114 (+ strand)
Length: 522
Type: CDS
Source: GLEAN
Position: GCSC_97:794169..794651 (+ strand)
Length: 483
>GLEAN_590 class=GenePrediction position=GCSC_97:793593..794651 (+ strand)
ATGGCCTTGTCGACGGCATCGCCATCGGCTTCCGCGGCCGTCGCCATGGCCTCGTCGATCCCGCGCTTCCTCCTTCCCCG
CCGAGGACCCATGTGGCAGCAGCAGGGCCTCGCTGTCGCCGGCATTTTGCAACGCCGACCGACAACAGCAGCTTCTGCTA
CAGCACCAGCATCAGGCTGCATCGTGGCCGCAGCCTGGCGACATGCATCGTCGGCCCGGTCGTCGCGCTGGACACCACCG
TCTGCACCGTCTGCGTCGTCGACTGCACCTTCCCCTCCCCCTCCCTCTCCTTCTGCCGTGCTTGAGAAGCCGGCCAAGTT
CAATCCGCCTTCGCACGGCTCGCGGCTGCCGCGCAAAGGCGCCGCCGCTCGCGCGCCGCCGTCGCTGCACTACGGCGGCG
AGCTCTCGCCGGCCGAGCGCCAGGCTCAGCGGCTGCGTCAGTATCCCGGCACCATGGCGCCTCCGGGCACGTGGTCGCAC
TGGTTCTGGAACAGCCGGGCGCTGCACATGGGCATCACGATGGTGGGTGCTCCGTTCGTCGTACTGCACGAATTTGTGTG
TGCTGACTAATCATAGACGGCCCTCACCATCCTCGCCATCTACACGTTCCTCGAGAACTTCCGCCGCTCGTCGCCCTTTG
TCGACATGCTCCCGACGGCCGCCCAGGCGCTGCGCCATCCCATCCTCGCCGTCCGCACCGCCGTCGAGGTCTTCCGCTTG
ACCGAGGACCAGCGCATCGCCGAGATCTCCGAGAAGCGACAGCGCCGCGTCGACGACGTCTCCAAGCGCACAATGTACCG
CAAGGCCCACGGCCTCGAGGAGACCGTCGGCTTCAACAGCGGCTGGCTCACCGGCGGCGTCAAGAAGGAGGGGCCCACGG
CTCCGGCCCGCAATGAAGAAGCCCCCGCCCTCAGCCCGGTCGAGGCCGTCGCTGCTGCCGCTGCTGCGACGCAGTCGGCC
GTGGACGATGCATCGCCCGTTCACGGTGCCCTGCCTCTCGATGGGCAGGCCGGCACAGATGCTGCCGGCACGCGGAAGCG
GTTCCTGGGCATCTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62