GenePrediction:GLEAN_5910 Details

Name: GLEAN_5910
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:203005..201265 (- strand)
Length: 1741
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:203005..202979 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_173:202920..202635 (- strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_173:202532..201265 (- strand)
Length: 1268
>GLEAN_5910 class=GenePrediction position=GCSC_173:203005..201265 (- strand)
ATGGCGTCTCGCGGCCCAGAAAGCGAAGTAGGTCTCCTTCTTGGCTGCCAAAGGACGAGGAGCTGACGGACGGTGTCATT
AGCAGCTCAATCGAGACACCAACTCGTTGCGCAAGGAGGCGCGCACGAAGAAGGAGCTCCGGCTGGTAGAGGAAGACAGC
GCACGGCGGCGGTCGCTGGCGACGATGGCAGAACACCTGATGCAGCCAGCGACGGTGCACTCCCTAGAGGTTCACGGGGC
CCGCAACACGCGGCGGTCATTTTTGGACCCGGTCCTGCAGCCGCTCGTGGACTCGGGCCGCAATGTGGGAACGACGCTGG
GGGACGTGCTGACGGAGGTGCAAGAGGCCGTGAGCAAGCTGGAGCGATTTGGTGGGTGTCTCTTTTTTCTTTTTTTTTTT
TTCTTTCTTCTTTCTTCTTTCTTCTTTCTTTCTTTCTTTTTTCTTTTTTTCCCCCCGTCCACTAACAGGATAGACATCTT
CAAGCCGGCTCCCACGGTGCACCTGTCGGACGCGCGAGCCCGTGATCCCCAGGCCGCGGCCACGGACCTGGACATTGCCA
TCCGGGTGGCTGAGCAGCCGCGGTTCCGGCTCAACACCGGCACAGACCTGGGCAACACCGAGGGTTCAGCCTACGGCAAC
CTGCTGTGGCGCAATATGTTTGGCGGTGCCGAGACACTCTCGCTCAGCGCGCGGGCTGGCACGCGCACGCGCTCGGCCTA
CAGCGCGGCGTTGTCGGCGCCGCTGGCCAGCAACCCGGATCTGGTCGTCACGCTCGAGGGTCTCGCCTCGGCCACCCAGA
AGCCGTGGGCCAGCCACGAGGAGGCCCTGCATGGCGGTTCCCTGCGTCTCGGCTGGCGCTCGGCCGCCGGCCATGTCCAT
AGCTTCGCCTACTCGTCCACATGGCGCCAGGTTACCGGGCTTGCCGGCACCAGTGCTTCTCCGTCTGTCCGCGCCGACGG
CGGCGACTCGCTCAAGGCTGCCCTCGCCCACACGTTTGTCTGCGACCGTCGCGACAGCCCGCTGCTGCCCCAACAGGGCT
ATCTCGTCCGCACGGCCGCCGAGCTCGCCGGTTGGGGTCCTCTCGGCGGCGATGTCTCCTTTGCCAAGGCCGAGGCCGAG
CTGTCCGGCGCCTTGCCCGTGTCGTTGCCATTTTCGTCTTCGTCTTCGTCTTTGTCTTTTCCTTCCCCCTCGGGCATCTC
CGTTGGAGCCGGTCTTCGCGCTGGCCTCATGTACCCCCTCCCCTTTGGCTACAAAGTCCTTTCCGGCACTGCCGCGCCCA
GCCGCATCAACGATCGCTTTCTGCTTGGCGGCCCGTCCGACGTGCGCGGCTTCAAGATCGGCGGCCTCGGCCCTCACGAT
GGTGCTGATGCTGTCGGTGGTGATGTCTTTGCTGCTGGCGGCATCAACGCCCTGCTGCCCGTCACGCGTGCTGGCGCCGC
CTCGCCGCTGCGCCTGCAGCTCTTCGCCAACAGTGGCTGCCTCGTCGCCCTGCGCCACCGCAAGACCAAGACGCCCGACG
AAGGTCCGCCGGCGCTGCACTCGGATGCCGTCGCCCGCAGCGTCGTCGCCGCCGTTCAGGACCTCGCCAATGGCCTCCCC
AGCACGGCTGTCGGCTTCGGCCTTGTGTACGCACATCCTGTCGCCCGCTTCGAGCTCAACTTCAGCCTCCCGCTCGTGCT
GCGCCGTGGCGAGGAGAGCCGCAAGGGCCTACAGGTCGGCGTGGGCATCAACTTTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62