GenePrediction:GLEAN_5913 Details

Name: GLEAN_5913
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:178215..177444 (- strand)
Length: 772
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:178215..178182 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_173:178114..177444 (- strand)
Length: 671
>GLEAN_5913 class=GenePrediction position=GCSC_173:178215..177444 (- strand)
ATGGCTCGCCTTGTTCTCGCTGCTCTGCTGGCTTGTATGTGTCCTGAATCCCCTCCTGTTCTCTCTCCCATTTCTACGAC
TGACAACTGACTCTCTCCCAGTCTCTGCCGTCGTGCAGGCCATGCCCAAGCCCGTCGTTCTCAACGAGCGAGCCATCAGC
AGCATAGCCGTGGCCGTTGCAACGTCATCCGCACCGCCGGCAATCTCGTCCGCCCCCGTCGCCTCTGCCTCCTCGACGAC
AGACACCTGTGTTGTCGATTCTAGCCTTCCCGGCAGCCAGAGCGTCGGCACCGGCGCCGGTGCCCAATTTATCACCGGCC
AGTGCTTCAGCAAGGACGACTGTGCCTCGGGCTGCTGTGTCGCCCAGTCCGACGGCGTCGCCCTCTGCAAGCCCGCCGTC
GTCACCGCCGAGGAGGGGCTCAGCTGCGACTTTTCCTGCTCGGCCACCGTCGCTGTCCGTGATGCTCCCGCCAACACCAC
TGCTCCTTCCACCAACAGCACCTCTAGCGGCACCGCCGTTTCTGCCGTTGCCGGCTCTACCAACACCACTTCGCCTGCGA
CTGCCGCCACCTGTGCCATCGACTACAGCCTTCCCGGCAGCCAGAGTGTCGGCCCGGCCGCCGGTGCCCAGTTCATCACC
GGCCAGTGCTTCAGCAAGGCTGACTGCGCCTCGGCCTGCTGCGTCGCCCAGGCTGACGGCGTCGCCCTCTGCAAGTCGCT
GATTGTGACCGGAGAGGACGGTCTCAGCTGCGACTATTCGTGCACTTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62