GenePrediction:GLEAN_5916 Details

Name: GLEAN_5916
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:168402..166953 (- strand)
Length: 1450
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:168402..168066 (- strand)
Length: 337
Type: CDS
Source: GLEAN
Position: GCSC_173:167991..167022 (- strand)
Length: 970
Type: CDS
Source: GLEAN
Position: GCSC_173:166959..166953 (- strand)
Length: 7
>GLEAN_5916 class=GenePrediction position=GCSC_173:168402..166953 (- strand)
ATGCTGTCAGGCATTCTCATCTTCAACCAGAAGGGTGAAAATCTCATTTTTCGGGCGTTCCGCAACGACTGCCGGCCGCG
GCTAGCCGACGTGTTCCGCATCCAAGTGATTTCGAATCCGCAGGTGCGATCGCCAATCCTAACGCTGGGCAGCACGACAT
TCAGCCATGTGAAGCACGAGAACATCTACCTGGTGGCGATCACGAAGAGCAACGCGAATGCGGCGCTCGTGTTTGAGTTT
CTCTACCGGCTGATCCAGCTGGGTCGTGGGTACTTTGGCAAGTTTGACGAGGAGGCGGTCAAAAACAACTTTGTGCTTGT
GTATGAGCTCTTGGACGGTAAGTCTCAGTCTGGAAGAGGGGGTTTGTGGGGCGCGCGGTGGTTCCGTGGTGCTGACAACG
GGGCGCTGCAGAGATTATCGATTTCGGATACCCGCAGAACACGGAGACGGACACGCTCAAGATGTACATCACGACGGAGG
GCGTCAAGTCGGAGCACCGGGCGGAAGACTCGGCCAAGATTACGATGCAGGCGACGGGAGCGCTGTCGTGGCGCAAGGCG
GACGTCAAGTACCGCAAGAACGAGGCGTTTGTGGACGTGATCGAGGACGTGAACCTGCTCATGTCAGCGACGGGAGCGGT
GCTACGGGCGGATGTGACAGGGCAGATCGTCATGCGAGCCTACCTTTCGGGGACGCCGGAGTGCAAGTTTGGGCTCAACG
ACCGGCTGCTGCTGGACTCGGACACGGTGCAGGGGCTGCCATCGGGCAACCGGCAGGGCAGCAAGGCGACCAAGGCAGCG
GCGGGCAGCGTCACGCTGGAGGACTGCCAATTTCACCAGTGCGTCAAGCTGGGCAAGTTTGACTCGGACCGCATCATCTC
GTTTATCCCTCCGGACGGCGAGTTTGAGCTGATGCGCTACCGGTCGACGGAGAACGTGAACTTGCCGTTTAAGGTGCACG
CCATCGTCAACGAGGTGGGCAAGACCAAGGTCGAGTATAGCATCGGCGTGCGGGCCAACTTTGGGCCCAAGCTGTTTGCC
ACCAACGTAGTCGTGCGCATCCCGACGCCGCTCAACACGGCACGCATCACCGAGCGCTGCACGCAGGGCAAGGCCAAGTA
CGAGCCGTCGGAGAACAACATTGTGTGGAAGATTAGCCGCTTCACCGGCCAGTCCGAGTTTGTGCTGTCAGCCGAGGCCG
AGCTGACCAGCATGACGAACCAGAAGAGCTGGAGCCGGCCGCCGCTCAGCCTGGACTTTAGCCTGCTCATGTTCACGAGC
AGCGGCCTGCTGGTGCGCTACCTCAAGGTCTTTGAGAAGAGCAACTACAGCAGCGTCAAGTGGGTTCGCTACATGACTCG
TGCGGGAAGCTACGAGATACGGTGAGTTGTGCCGGTGCTTGTTCTCTCTTTCGTCTGCGGCTGCTGACTTTTGACCTCTG
CAGATTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62