GenePrediction:GLEAN_5919 Details

Name: GLEAN_5919
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:154986..153852 (- strand)
Length: 1135
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:154986..154974 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_173:154891..154795 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_173:154710..154637 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_173:154569..154422 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_173:154364..154306 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_173:154246..153852 (- strand)
Length: 395
>GLEAN_5919 class=GenePrediction position=GCSC_173:154986..153852 (- strand)
ATGTCTTGGGCCGGTATGGACAATGGACGACAGGACCCTTCGGCCGATGTCTGGGCCGCTCGTGCTGTCCTCCCGCTAAC
GTGGACCTCGTGCAGGATTCAAGAAGAATGTCAACCGCGCGACGACGCAGGTGATGATGAAGACGGGCCATGTGGAGAAG
ACCAACGACCGCGACTACGAGGTCGAAGAGAGGTAGGCCCAGCCCGGACCGGATTCCCGGTCACCCCGACGTGCGCCAGA
CAGGACAGCTGACCGTGGCGGCACGACCACACGCAGGCGCTTCCGCACGATGGAGGCCGCCGCCAACCGGCTGCAGAAGG
AGGCCAAGGGATACCTCGACTCTCTGCGAGGTAAGGCAGACCGATAGCAGGCATCCGCACCAGAGCAGCCCGGGCTACCT
GACTAACCGGTTCGCAGCCATGACGGCTTCGCAGATGCGCATCGCCGAGACCATCGACGCCTTTTACGGAGATGCTGGGG
CCAAGGACGGCGTCAGTCGGAGCTACAAACAGGCTGTCGAAGACCTGGACTCCGAAACTATCAAGGCTCTGGATGGGCCG
TATCGGTGCGCACGCTTCTCTCCAGCCGTCTTGCTCGTCACTGACACCCCCCTTTCCCCCAGAGCGACTGTGTTTGACCC
CATCTCCCGCTTCTGCAACTACTTTCCCGACGTCAACGAATGTAAGTCCTGGCGGCCTTCTCGCCCACATCTCGACACAA
AACACTGACCCCCAAGACAGGCATCAAGAAGCGCAGCCACAAGCTGCTCGACTATGACGCGCTGCGGGCCAAGGTCAAGA
AGCTGGCCGAGAAGCCGGACAAGGACGTGACCAAGCTGCCGCGTGCTGAGAAGGAAATGGAGTTTGCCAAGCAGGCCTAC
GAGACGCTCAACGAACAGCTCTCGACCGAGGTGCCCCAGCTGATCGAGCTGCGCGTCCCCTATCTCGACCCTAGCTTCGA
GGCCCTCGTCAAGATTCAGCTGCGCTTCTGCGCCGAGGCCTACAGCCGCATGGCCCAGGTCCAGCAGTACCTTGACGCCG
ACACCCGCGATCAGTACGCCAACGGCGAGCTCGACACCCGTGTTGAGCAGGTCCTGCAGGAGATTCGCGAGCTCAGCATC
AGCGGCACCGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62