GenePrediction:GLEAN_591 Details

Name: GLEAN_591
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:809625..810675 (+ strand)
Length: 1051
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:809625..809956 (+ strand)
Length: 332
Type: CDS
Source: GLEAN
Position: GCSC_97:810021..810675 (+ strand)
Length: 655
>GLEAN_591 class=GenePrediction position=GCSC_97:809625..810675 (+ strand)
ATGACTCGACAGTTCCACGAGCAAGAGACCGGACCAGAAGCTTCTTTCTTCGTCTCTCCACTGCTCTTCCACATACCCTC
CCAGAACAGCATCATGACCGCCTCCCTCGACAAGGTGCCCTCGCCAGAGCAAGCCGGAGTGGACGAAACCGGCGACGCTG
CACTGCCCAACGGGAAGCACCAAGCGCCCCAGAACGAAGACGACAAGGGCGAGGTCTCGTCCGAAACAGCTACAGAGTCT
TCCGAAGTGCCGGCCACCAAGCGCCGCACGCTCTGTGGTGTGTGCCACAACGAGGCGGCCAAGTACAAGTGTCCCCGTTG
CTCGCTGGCCTAGTACGTGTAGTGTCCTGCTCTGGGCCTGGCTCCTGCTCCGCCCTGCTTGCTGACCTCGAAACAGCTGC
TCCGTTGCCTGTTCCCGCACTCACCGCGACAGCCACCCGCCAGAGAACGACGACATCGTCACCGCTCGTACCGCTACGAC
TGCTGCCATTTTCCCCACACCGACAGCACCTCAGACCAGGCGTCACCCCTTTAGCGTGCTCGACGATTCAGTGGAGCTGA
AACATCTGTTCTCCAAATATCCCCACCTTCAAGCCCGCCTGCGGGCCATCTACGAGGCCACGTTGCCGCCGGCATTACGA
CAGAACCAAAACGAGCAGCAGGGGCCTTCTTGGGAGGCATCCTCGCGGGGCCGGGGCCGTGGCGGCTACCGCGGTGGTGG
TCGTGGTGGCGGCGGCCGCGGCGGCAGCCAAGCAGGCCCAGCTCCCCGGCTCGACCAGCCATGGACGACAGAGCTTGGCC
TACGGCAGGGTCAGAAGGCGCTGCGACGGGCCCGTATTGACCCCGGGGAGGACGGTGACAGCGTCCGCGAATACTGCGAG
CTGGTGACGTACCTGCTGGCCAGAGGAGAGGACGACAAGAACGCGGCAGCTGCGGCGGCGGTAAATAACCTTACGGCCAG
CGATGCTGCTACCGCATTGGTGCAAAAGGAAGTCTTTCAAGGAGACGTTTCTCTCATCAAACGACTCTTAGAAACCGACG
GAGACCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62