GenePrediction:GLEAN_5920 Details

Name: GLEAN_5920
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:148338..144462 (- strand)
Length: 3877
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:148338..148149 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_173:148085..147977 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_173:147780..147622 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_173:147547..147499 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_173:147366..147289 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_173:147226..147093 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_173:146873..146631 (- strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_173:146571..146457 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_173:146037..145430 (- strand)
Length: 608
Type: CDS
Source: GLEAN
Position: GCSC_173:145367..145311 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_173:145083..144462 (- strand)
Length: 622
>GLEAN_5920 class=GenePrediction position=GCSC_173:148338..144462 (- strand)
ATGGAGAAGACTAAGACAGATATTGAAATGGTCGAGGACCGCGGCGATGAACCGAAACCCAACGCCACTGCCGGCAAGCT
GATGCGCTCACAGGTCGATGATTTTGGCATCTGGAAAACCGTGCGCCTCTTCCAGCGCGTCGGTTGCATCGCCATGGCCG
CTGCCTTCTGTGCTTCCCCGGACGGCTACCGTATGTGATGAGCGCGGTCTTTCTCAGCAGGGACCATCTAATGCCTTCTC
TCTCCTCTTTCAGAAATCAACCTCAATGCCGACATCGTGTCTAGCAAAGGCCTCATTCGCCAGATGGCCAAGCCTGGCAC
GACCATCATCGACGGAAGATACGTCTCGACCTGGGGCAGATCGTAAGTAGTGTGGCTTTTGTTAGCTGCCAGAAAGCTGC
CGATTGCTGATCCCTCTCACCTTCCTGCAGCTACTCCAGTTTGTGACAGAGAAGTATGGCCGCAAGCCCGCACTCCTGAC
CATTTGGGCCATCCTAACAGGGGTGAGGTTCGCACCCTGACTATATCACATGGGCACGCACTCACGCACATCTCAGAGCG
TCTTCACCGAGACCTTTTCCACCTGTTGGGACCACTGGCTCGTAGCTAAGCTGCTCTCGGGCCTGGGCGTCGGAATGCTG
CTGTCTACCATACCGCTGTACCTGTCGGAGATCACCCCGACGAACCTGCGTGGCTTCTACATTAACGCATACACTTTGTA
GGTCGTCCTTCTCGGTCTGTCTGCAGCTGGTTTATCATTGGTCAGCTCTTTGCCTCGGTGGCCTTGAATAGAGTCAACGC
TGTTGACCTCCATAATTTTAAGACGCCCATCTACACACAGGTGAGACCGAACATGAAAAAAGAAAGAAAAAAACATAACG
ACACTGCTCACACTCTACAGTGGACCATGATTGGCATCATCGTTGCCATCTTTGCCTACCTTCCCGAGTCGCCCTGATGG
CTCGTCAACCAGGGCAGGATGGACCAGGCAGCCAAAACGCTGAGGTTCTGCCATGGTGACGTCCCGGGCTTTGATATTGA
CGAACAGCTGGTGTGTCTCTTTCTCCGGTCCTCCGGCTCCTTCTGCGCTAACCCCCTCGTGCCCCTCCACAGGAAGTGAT
GAGCGCCACCGTAGCCAGCGAGCGAGAGGCGGCCGAGGCCAACAAGGAGCTGGGCGAATGGGCCGTGTTCCAGGGCCGCA
ATCGGATCCGTTTCGTCATCGCCGGCTGGCCCAAAGTGGCGCAACAGTTTGTCGGCCTAAGCTTCCTGCAGTCCAAGATG
CCGGCTTCGCCAACCTCTTCATGGTCACGGTCATCCTAGCGTGTGTGCAGTTGCTGTCCATGATCATTACCGCCTCGGCC
ATTGACCGTCCGGGCCGTCGTCCGCTGACCGTGTATCCTTACGTTTTGACCGTGCTGTCGGTCCTAGCTCTCGGCATCGC
TGGCTGCTATGACTACACCACCAAGGCACTCAATCTCCTTTGCTCTGTTCAGATCTTCTTCGCCTGCCTCGCTACCTTCT
CTACCACCGGTGCATCGGCTATTGGCTATTGGCTATGCCTATGCAGCCGAGATCCCCCAACAGCGACTGCGCGCCCGGAC
GACTGCCTGGTCGCTCGCGGCGTCCAGCATGGTGGCCACCATGTCCAGTTTCTGCTCGCCGCTGATGATTCATGGCACCG
CCATTTGGGGCGTCAAGACAGGGTTCTTGTGCGTTGGCGATCACTGACTTGGCCATTATATTGCTCTTGCTGACATATTG
CTGTTAGCTTTGCCGGCTCCGGTTCTGTGGCTACGTTGATTGCCTGGTTCATTCTGCCCGAGGTGTCGCAGCGCACACCG
GCCGAGATTGACGAGCTGTGCGCCAAGTCCTCCTACACGTCTGTATCTTTGCGTGATTGCTTGCCTGCTGACTCAGCTCA
TCACGGGTTCGATAAATACGTGCCTCTGCGCAAGTTTGACAAGTGCAGATGCGCGCCGACGAGGTGTATGAGAAACGTGG
GGCAGTGGTTTAGGCGCACGGCAGAAGTGCGATACAGAAGAAGATTGCGCTGAGAATGCGCTTCAATTTGTGCAGTGTCG
ACATGGTTAGCCAAATTTGATGTCATCGCCAGAAGAAGTCTGTACGGAGTACGTCGTAGCAGGAATACATGCTGACCAAC
CAGCGCAGCATCGGCTAGCGGTACGTCGGTTGCAGCTTCCTGCCGACGCCAGGAACACAATGGTCGTGGCTTGCCAGATT
AGGAGTCGGTTGGCGTCTTAACCCCACCGGCTGACGTGATGGGGCCGCCGCTATTGATTAGCAATGCCGCACTCCGTATC
TCGGATTTAGCTTCAAGCTATTCCGTATCGTCTCTCGATATCATCCACCACCGCCCATCGCATCGCTGCTCGACGACTTG
CCCGCCATGGCTTCCGCGAACGACACCCTTGCTTCCATGCGCATACGCGCCTCTACCTCGCTCGATATTCATATATCGCT
CAGCCAGGAGCTCGGCAGTGCCAGCCGTAGCGGCAACAGCAGCAGCAGCAGAAACCAGCGTGCGACTGCTGCCATGGGCA
CCATGACCGTCACGCCTAACAAGAGCCTTAAGGGCCATGTGCTTCTCATCACAGCCCCCTGGGAGCCTTCAAAGGCGTGG
ATCGACCAGGTGCACGGCCGCCACCCGGGTCTTCGCGTGATCTTCCGCAAGCTGAGCTTTGGCGAGACGCTTGAGCGGCA
GTCATTGCCAGACGAGGACTGGACAGCCGTGACGATCCTGCTGACCGGCGGGTTCGGACTGCCACTTCCCGAGCAGATGC
CGAAGCTGCAGTATGTGCAGCTGATCAGCGCAGGCGCCAACATGGTCCTCAAGCAGCCACTGTTCGCCGATACCGACATA
GTATTCGCCACCGCCAACGGCGTCCACGGGTGAGCATTCGGGAAGCAGAGACCAGTGTGAGGGCTGCCTACAGAGTAGCT
GACTGGTACAGGCCCCAGATTTCAGAGTGGATCATCGCCACGTACCTGGCCTTGAGCCACGAGAGCATGTACCCCATCCG
GCCATGTCGAACGTGTTTGCGGGCGGCATTGGCTGACCGATAACCCATAGTTCCTTCGTATCTAGAGCACCAGCGTGCCG
GCAAATGGCAGCGCACGACAAGTGCTATAGAAGACTCAGTGGGCCTGCGAATGTAGGTGCACTATCCCCCCGCTATCTAC
TCCGGATAGCTTCTGTTGTTGGTTTCCATCTACCTCCCTAAACTCACCTTCATAGCGGCATCCTGGGATACGGTAGCATC
GGTCGGCAGACGGCCCGCGTGGCCAAGGCGCTCGCCTTTGAGGTTTATGCGTACACGCTGCATCCGCGCGATACGCCCGA
GTCGCGTCGCGACAACGGCTATGCGCCTCCGGGCACGGGCGACCCCGAGGGCGTCTTCCCAACACGCTGGTTCTCGGGTG
GATCGCCCGAGGACCGGCATGCGTTCCTGAGCTCCGGGCTGGATCTGCTGGTGGTGGCCACGCCGCTCACCGCCGACACC
ACGCACCTACTGGGCGCCGAGGAGCTGCGGCTGCTGGGTCGCCGCCGTGCCGACGGATCCTGGCGCCCCGGATTCCTTAG
CAACATTGCGCGGGGACCTATCGTCGACACGGACGCGCTCATCACGGCGCTCGACACGGGTGTGCTGCGCGGCGCGGCCA
TTGACGTCACCGATCCCGAACCGCTGCCCGACGGCCACCCGCTCTGGAAGGCCAAGAACCTCATCATCACGCCTCATGTC
AGCGGCATCTCTACGAGCTACATGGACCGCGTGCTGGACATCCTGTCCGGCAACCTGGACCGGTTCAGCGAGGGCCGGCC
GCTGGCCAACAGCGTCAACCGCAGGGAAGGTTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62