GenePrediction:GLEAN_5925 Details

Name: GLEAN_5925
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:133361..132889 (- strand)
Length: 473
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:133361..133317 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_173:133203..132889 (- strand)
Length: 315
>GLEAN_5925 class=GenePrediction position=GCSC_173:133361..132889 (- strand)
ATGCCTACTTCGTTGGAGTCTGCTCGGCCCATCATGGCACCATCCGTACGTCTGGCTTAGCACCCCTCATCTCATTCCCT
CTCTCTTCTTCTTTCGCCATTCTCCCTTCCTTCTTCGCCACTGCTCCCGGAGATGTCTATATACTGATCTACTTCCAGGC
CCGCACCTCAGTCCGCTACAGCACCTACAGCGTCGCACCCTCGTGCGCCCCGACATTCCAGACTACGGACTCCGCCACGG
CCGAGATCCACACCATTGAGCAGAATCTCGTCCGCATGGAGAACAAGGCTCTGCAACAGCAGCGCGTTTCCCTGAATGAG
GAGAAGACAGCCGTGTTCCAGAAGCTGGCCCTAGGCGCCAAGCTAGATCGCGCCCTCGAGCGTCGCATGACCAGCCAGGA
TGCTGTTATGCGCCCTCCACGGGCCAAGAAGACCGACTCGACCATCCTCGACGAGAAGAGCGAGAAGCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62