GenePrediction:GLEAN_5926 Details

Name: GLEAN_5926
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:122613..120986 (- strand)
Length: 1628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:122613..122559 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_173:122419..122186 (- strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_173:121970..121897 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_173:121822..121653 (- strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_173:121562..120986 (- strand)
Length: 577
>GLEAN_5926 class=GenePrediction position=GCSC_173:122613..120986 (- strand)
ATGCTGAGCGCGGCAGACTTGAAGGCCATCAATGAGGCTCTAGTGACTTTCAAAGGTAAGCCACTCTTTGGTGTCAGAAA
CTAGGTACTACTTATTGCTCCTGGATTTTGGAGTCTGGTCGGAGTAATTAACGCCTAGCAATAAATTCTCGGTACCTCAG
GTGGAAATGTTTTGCTCGCTAATTATCCACAAAGCTCTTGAACTCGCCGGCCACGAAGTTTCCAAAGAAACGTTTCCATT
GCCGAACGATTTAAGCGAAAGACTCTCTTCTGCTGCCTATGAGGTTCACCGGGGCCGTGGCCTTTGCCAGATCCAAGGCT
TGGATCCTACGCTTTACTCGGAGGCCGACAATCTCCTAGTCTTCCTTGCAATTGCCAACTACATTGGAGACAAGCGGGGC
ATTCAAGACAAAAAAGGAAATGTGATAAGTACGTATTGCACCCATTTGAAGCCAGCAACAAGGAACATATTACCTTAAAT
GAAAATAGCTCTATGGTCCAGTACTAGAAAGGCACCCGCGCAATCCCGAGGGTAATTTCTGGGGCTATATTCAGCATTGA
CTTGTGTTTCTCTTTCTTCTATGATCTTGATCCGAGTCGGTCTACATATAGTTGCATAACTGACTGACACTGACACAAAC
CAGCTCACATCACCGATGCAAAGGCCTGGACAGTCCCGTATGAGAAGCGTCATGTTGTTCACACAAACCAGCATCTAGTA
AGTAGCGCCTCCCCATATACCTCAGGTATATGCCGTAGTATTCCGACCTGTTCACTCACACACTGTCTTAGACGTGGCAT
TGCGACATGGGTGCCGATGTTCTAGCCCTCCAAGTGCGCCAAGTCGCCGCAAGGGGCGGAGCTACCATGGTAGCTTCGTC
TTGGAAAATCTACAATATCGTCGCTTCTGAGCGACCGGATGTGATCCGAGTTCTAGCCGAACCAAACTGGCCTGTCCATG
TGTGAGCTGAGCAAGGGGACGATGCTAGCCCCTTCTAGCCCATATACTCGTCCTTTCTCAACCAGCTAATTCGTGTTTAT
TGGTCTGTTAGCTCCAACCGCAAGTCTCGTCATGTCCTCGCCTCTCTGCTGGAGTTTCATGACGGCAAGCTGCTGATGAA
CTTCGACCCGAGCCGATTGGGAACTCATCCGGCCATGAAGCCCCGCCGCTCGCGGCCCGTCGCTATACCCTCCCTCACAG
AGGCCCAACAGGAAGCACTTCGCGTGGTGGCGGCTGTCGCGGAAAGGAATAGCTTACAGCTTGGCACCAAGGCGGGAGAC
ATCCTATTCATCAACAACTGGGCTCTCCTTCACGCGCGTAGTGCGTATACGGATTCCGGTGAGGAGGCCGAGGGTCAAGG
GACAGTCAACCAACGGCGCCATTTACTTCGCCTCTGGATTCGAAACTCGCAGCTGGGCTGGAAGATTCCAGAAAACCTTC
GAGCTCCTTGGGAGGCGGCTTTCAGCTACGCGGACGAGGGCTATGTTTCGGGGGACCATCAGAACGGTGCAGTCACTCAG
CTAAGATATCCCGTCATGCCAGAACCGGATTACAAGCCAGCAAGATACACGACCGGATCCGCTGCATTCGTAATTGAAGA
CAGCGAGAGCGAGTATGACGATGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62