GenePrediction:GLEAN_5927 Details

Name: GLEAN_5927
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:112645..111194 (- strand)
Length: 1452
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:112645..111194 (- strand)
Length: 1452
>GLEAN_5927 class=GenePrediction position=GCSC_173:112645..111194 (- strand)
ATGCGGATCGGGCCGTGTGTTGGCAGGGCCGTCTGGCAGCACCGACGGCCGTTCTCTTCGGCGTCGACGCTGCGCGAGCT
GCGCGATGCTGCCAGCCTTCCAGACCGCATCGAGCCGCGATACGAAGAGAGCCCGCCGTCTTCGCTGTTGTCGCTGCACT
GGCCGCAGCCTCCGCGCAACATCCTGATCATCCCCAAGCTGCACGTGCCGCGCGTCACGCGGTCGGCACTGGTGTTTGCC
GAGCACCTGGCACGCAACTATCCGGACCTGAATCTCGTCTTTGAGCATCGCGTCGCCCAGGCCGTCCACGAGAGCTTGCC
GTTCCCCATCTACACGACCGACAGCAGCCAGACACGGACGCTATTTCCCGACAAGATCGACCTGATCACCACTCTGGGCG
GCGATGGCACCATCCTGCGCGCCGCCAGCCTCTTCTCGCTGCAGCCCAGCGTGCCGCCGGTCCTCTCTTTCAGCATGGGC
ACCCTCGGCTTTCTGGGCGAGTGGAAATTCGAGGAACACAAGCGTGCTTGGCGCGAGGTATATATGAGCGGCAGCGGTGT
CGCCGTTGACGATCTGGTTGCGCCACATACCCAAATTGCAGCGGGTAGTGTTGGTGATGGTGGTGGTAGTGCTGCTACTA
GCTCTGCCAGCTCCGAAGAGAATGCAGAGGCGCTGGCGGCATGGGGGAGTGTCCGCGGCCAGAGTTTGGGGGTCAAGCGT
GTGTCGCGCATGCTGCTGCGGAATCGGCTCAAGGTCGGCGTGTACGATCAGGCTGGCGTCAACATCAATGACAAGCTGAC
GTCCATCCCGGCCACAACGACGACATTTTCCAGCCCGACTCAGCAGGCAAAACAGGTTGGCCCTCCTTGCCCTCCTCGCT
CTCCAGTGGCCGCCAACACGCCACCGCCTGCCTTCCATGCTATCAACGAGCTGCTCATCCACCGTGGCCCGCATACACAT
CTCGCCATTATCGACATCTACATCAACGACCACTTTCTGACCGAGGCTGTGGCCGACGGCATCCTCGTCAGCACGCCCAC
CGGATCGACGGCCTACTCGCTCAGTGCCGGCGGTGCCATCATCCATCCGCTGGTCGGCTCGCTGCTCATCACCCCTATCT
GCCCGCGCAGCTTGAGCTTCCGGCCGCTGGTCCTGCCGCTCAACACCAAAGTGTCGCTGCGGCTCAGCGAGCGCAACCGC
GGACGCGATCTCGAGGTCAGCATCGACGGCAAGCGCAAGGCTGGCGTCGGCATCGGCATGGAGGTGCGCGTCGAAGGCGA
GGCCGTTGGCCGCACTGCCGACGGCAGCTGGCGCGGCGGCGTGCCCTGCGTCATCCGCGCGCCCCGTCATGGCGCTCGCG
GCGTCTTGATGGAGGACGACGACGGCTGGGTTGGCGGCCTCAACAGCCTGCTCAAGTTCAACTATCCGTTTGGCGAAACC
CCCGCGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62