GenePrediction:GLEAN_5928 Details

Name: GLEAN_5928
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:108236..106940 (- strand)
Length: 1297
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:108236..108076 (- strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_173:108011..107983 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_173:107905..107779 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_173:107685..107597 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_173:107529..106940 (- strand)
Length: 590
>GLEAN_5928 class=GenePrediction position=GCSC_173:108236..106940 (- strand)
ATGCTCGCTATCTCACGGTGTGCACGGCCGTCGCTGCTGCGACAGGCTGCTTCCCGTACTTACAGCTCGGCGGCCAGCCC
TTATGCTGCCACCATTAACAATCTCCGCATCAACTCGGACACCAAGGTTCTCTACCAGGGCTTCACCGGAAAGCAGGGAA
CGTGAGTGCACCATATGCGCCGGTGCCATGGGCTCAATTGCCTTGCTAACTCAGGTCCTGAACAGCTTCCACGCCCAGCA
GGCTCTTGACTACGGTAAATAGCTCTACTCTTGTTCTTCGACACCCCCCCTATATGCGACTCCTTGCTCATGGCCACTGT
CTGCACAACAGGTACCAAGGTTGTTGGCGGAACAAACCCCAAGAAGGCCGGCACCACACACCTGGGCCTCCCCGTTTTCG
GAACGGTCTCAGAAGCCGTCAAGCAAACTGGCGCCACGGCCACGGCCATCTTCGTTCCGTAAGTAGCCGCAGCTCCACAG
GTCGGCATAGATGCTACCGAGGATAGCATCCGATATGACATCATGGTCAGCTAACTTGCATCCCACGATAGCCCACCTGT
GGCCGCAAGCGGTATTGAGGAGGCAATCGCGGCCGAGATCCCCCTCATTGTCTGCATCACGGAGGGTATCCCGCAGCATG
GTGAGTGTTGTTGTTTTGCGCACAATGGTCCACAAGGATGCAAGTATGTTCTAACACCCTCCTCCAGATATGCTCCGCAT
CACCAACATCCTGAAAACCCAGTCCAAGACCCGTCTCGTTGGTCCCAACTGCCCTGGTATCATCGCTCCTGGCCAATGCA
AGATCGGCATTATGCCCGGCTTTATCCACAAGCGTGGCCGTATTGGAATCGTCAGCCGCTCCGGTACCCTCACCTACGAG
GCTGTCAACCAGACCACGCAGGCCGGCCTGGGCCAGTCCCTCGTCGTTGGCATCGGTGGTGACCCGTTCAGCGGCACCAA
CTTCATCGACTGCCTGAAGGTGTTCCTTGCTGACGAAGAGACCGAGGGCATCATCATGATTGGCGAGATTGGCGGTTCGG
CTGAGGAGGATGCTGCCGAGTTCCTTCTTGCCAACAACACGGTCAATGGCGGCAAGCCGGTTGTGTCGTTCATTGCGGGT
ATCTCGGCGCCGCCTGGGCGTCGCATGGGCCACGCCGGTGCTATTGTCTCGGGCGGCAAGGGCGGTGCCGACTCCAAGAT
CAGGGCGCTGGAGGCGGCAGGTGTCGTCGTCGAGCCCTCTCCGGCCGGCCTGGGCAAGGCTCTGCGCGACGAGTTTGTCC
GCCGCGACCTGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62