GenePrediction:GLEAN_5929 Details

Name: GLEAN_5929
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:104322..102726 (- strand)
Length: 1597
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:104322..104320 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_173:104240..104175 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_173:104101..103289 (- strand)
Length: 813
Type: CDS
Source: GLEAN
Position: GCSC_173:103232..102726 (- strand)
Length: 507
>GLEAN_5929 class=GenePrediction position=GCSC_173:104322..102726 (- strand)
ATGGTACGAATAGGTTTTGGACTCTACTAGCTTTTTGCAAATCGAATATCCGGAGCGGTTCTCTAACGTTCGTTATCCAC
AGGGTCAAAACCAGTCTGGAATGGGAGGTGGCGGTCCCGGGGATGGCAGGGACGAGAAGGACAAGAAGGTATGTGGTGCA
GAGTGTGGGGATGATTGAGGTGATGGGTGGTAACATTGCTGACTGACGGTGCCGTGAGCAGAAGGACAAGCCAAAGTACG
AACCTCCGCCGCGGCCGACAACTCGTGTTGGGCGTAAGAAGAGAAAGGCCGGTGGCACCAGCGCGGCGGCCAAGCTCCCT
GCAGTATTCCCGACGAGCAGATGCAAGCTACGGCTTCTCCGTATGCAGCGTATTCATGACCACCTATTGCTCGAGGAGGA
ATATGTCGAGAACCAGGAACGCCTGCGCAAGGCCAAGGCAGCCAAGGACAACAATGCACCGGCCTCTGATCTGGATGCTG
GCAGCGACCGGCTGGCCGATGAGCGAGGTCGTGTCGACGACATGCGTGGCAGCCCGATGAGTGTCGGCACGCTGGAGGAA
ATGATTGACGACGACCATGCCATCGTGTCCAGTACGACTGGCCCGGAGTATTACGTCAGCATCATGAGTTTTGTGGACAA
GGACCTGCTGGAGCCCGGAGCCAGTGTTCTGCTGCACCACAAGAGCGTCAGCATTGTGGGTGTTCTGACGGACGACACGG
ACCCATCGGTCAGCGTGATGAAGCTGGACAAGGCGCCTATAGAGTCGTACGCAGACATTGGAGGACTCGAAGCCCAGATA
CAAGAGGTCCGCGAATCTGTGGAGCTGCCTTTGTTGCACCCAGAGCTGTACGAGGAGATGGGCATCAAGCCTCCCAAGGG
CGTCATTCTCTACGGCGCACCTGGTACTGGCAAGACGCTGCTGGCCAAGGCCGTCGCCAATCAAACATCGGCCACATTCC
TGCGCATCGTGGGCAGCGAGCTGATCCAGAAGTACCTGGGCGATGGCCCACGTCTCGTCCGGCAGCTCTTCCAGGTAAGA
TGCACAGGCACCCTAGCTGGATAAGTGAACCTGCTGACACTAAATCACAGGTCGCTGCGGAAAATGCGCCTTCGATCGTG
TTCATTGACGAGATTGACGCCATCGGCACGAAGCGGTACGAATCGACATCGGGAGGTGAGCGCGAGGTGCAGCGGACGAT
GCTGGAGCTCCTGAACCAGCTGGACGGCTTCGACGACCGTGGCGACGTGAAGGTGATCATGGCGACAAACAAGATCGAAT
CACTTGATCCGGCCTTGATCCGGCCGGGACGTATCGACCGGAAGATCTTGTTCGAGAACCCGGACCAGAACACAAAGCGC
AAGATCTTCACGTTACACACGTCCAAGATGTCTCTGAGCGAGGGCGTGGACCTAGAGGAGTTCATCGCGCAGAAGGACGA
TCTGTCTGGTGCCGACATCAAGGCGATTTGCTCCGAGGCTGGTCTCATGGCTCTGCGGGAGCGGAGAATGCGCGTTCAGA
TGGCCGACTTCCGGGCTGCTCGGGAACGTGTTCTTCGCACGAAGCAAGAGGGTGAGCCGGAGGGCCTGTATTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62