GenePrediction:GLEAN_592 Details

Name: GLEAN_592
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:813679..814611 (+ strand)
Length: 933
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:813679..813777 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_97:813859..814611 (+ strand)
Length: 753
>GLEAN_592 class=GenePrediction position=GCSC_97:813679..814611 (+ strand)
ATGTCGTCATCCATGCGAAACGCCGTCCAGCGGCGCTCCCATCGTGAGCGTGCGCAGCCGCTGGAGCGGAAGCGGCTTGG
CCTGCTGGAGAAGCACAAGGTAGGCATGACGAAACTGCTGTGTGCCAGGTGCCAGCTGAGACTCTTGTTGAACGTCTTAA
GTGCTAACGATTGCTTCAAGGACTACGCACTCCGTGCCAAAGATTGGTCGAAAAAGAAAGCAGAACTCCAGCGGCTTCGC
GAGAAGGCGGCCGAACGTAACGAGGATGAGTTCTCGTTCAAGATGTTGTCACGCCAGGGCCCGAGCTCTGCGCTGATGCG
CGGCAGCGACGAGAAGCGGGCGCGGAACTGGGACGGCACAACCCTTGGAAAGCGCGAGGGAAAGACTTTGTCGATGGACA
CGGTGCGGCTGCTCAAGACGCAGGACGCGGGCTATATCCGGACGGTGCGGAATGTGGTAGCCAAAGAGGTGCAGGCTCTA
GAGGAGCGGGCAGAGACGGCACGGTCGTTTGTGGGGCGGGGGCTGAACGAAAACGAGGAGGAGGACGGGGACGACGAGGA
CGCCGAGGTTCTGACCAAGGCCATGCTGAAGGCGAAGCGAAAAGCCAAGATGACCGGCACCAAGATTGTTTTTGCCGAGA
CGGCAGCGGATCGCGACACGGCCATGGTGGAGGATGAAGGGGACAAGGAGGACGAAGCGGAGGACGAGGACCAGACCAAG
GGCGAGGACTCCAAAGAGAGCGACGCACAGCGCAAAGCCGAGATGGCAGCGCGGCTACAACGACGACTGGCAACGGCACG
AATGCGGCTCAGAGCACTGACGGAAGCTGAGCAGGAGCTGGACATGCAGCGGGCACGCATGGCCAAGACGGCGACGGTGG
ACGTGATCACGCGGACAGGGAAGCGGATCAAGATGCGGGAGCGGAAGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62