GenePrediction:GLEAN_5931 Details

Name: GLEAN_5931
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:92168..90400 (- strand)
Length: 1769
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:92168..92045 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_173:91733..90400 (- strand)
Length: 1334
>GLEAN_5931 class=GenePrediction position=GCSC_173:92168..90400 (- strand)
ATGATCTCAAGCCACACGGAGCAGCCAAGCGAAGAGCAACCAGGGCTACGCTATATTAACACTCGTTATTTCTGCTCGAC
TTCCAATAACCTGCCCCTCTCTTCTGCGCTGTCCTCGTGGTCACGTACGGGTTCGACTGCCACATCATTTGCCGTCTTAC
GATTCGCCAACGCCGACAATACTCCCAGCGATCCTACAGTGAGGGACTAAGCTTTGAGGCTAAGCCCTTAAACATAGGTC
GGCGGCACCTGCGAAGCACCAGCGAAGCAGTCTAGTCAATCTACCCCTCCAACTATCCGACGTCTTTTAGAGGATCACAA
GTCAAGGCAAAAATCGGAATCATTTGGCCTCATTTGACTCTCTTGCCCCCTCTCTCTTTCCACCCACTGGTGCTGTGTGT
CGTGTCCTGATTCAGGACCGAAACACCCGCCAAAGTGGCGTCCGGCCCATCTGCTCTGGCATCATTGGGTGCCCCTTTTG
CCAGCCTGACCAACATCACGTCAGCGCTGCTGCCAAAGCTACCGCCTGCGCTACAGACATACCTTGATACCTCTATCGAT
AGCGTGTCTTTCGCCCTTAGCAGCTCGAACGCCTACCTGCAGTCTACCACTGGGTTCTCACCTACCACCGTCTACAGCAC
CGTCGTCGGCGTCTTCGTCCTCGGGGCCGCCAGTACTGTCGCTGCCAAGAAAGGCGGGCCGGTTGCAAAATCCAGCAAAA
AGAAAAAAAAGCGGAAGGCCGCCAAGCCAAAGGCCGAAAACATGAGCCGATATGGCTGGCCGTCTGGTCAAAAGCCTTCG
CTATCCCCATATACTACATCGCTTAGCCAGGACGGTGTACCGAACGTTACCGATGCCGACTTTGAGTACATCACATCGGA
TGGCGTGCAGGACGATTATGATGCTCAATTGGCTTTTGACTATGGTACTGGCAGCCGATCTGGCGGCTCCTACTTTCGCC
CACCAGACGAGGATATCGACGACATCCCGAAGGACGATGTGCTGCTCTTCCGTCGTGACAAAAAGGTCGATAGAGAGTTT
TTCCCCCCCTATGCCATTGGGGATGGAAAGCTGTACACCAGCGATGTGCTGGACCGAGTGCAGCTACTCTATAAATTGTC
TGACTCGCAAGCCAAGCGGGTGAAGCTCTATTACAAGGGGAAGCTGTTGAAAATCGAGGATCAGCCAGTGTGCCTTACTG
GCGTAAAAAACAACAGCGAAATATTGGTAATCGTCCCTCCGGGAGATGACGACAGTATCTCGAGTAATGAAAACGTCAGT
GGCTCGGGAACAGGTCGGGAAAAGACAGCAAAATCAAAGTCAAAGAAGAGCAAGCAGAAGTCCGGGCGAAACACTGCCCA
GGAGACGCCATCAAGCCCTACCATTGGATTGGAGGTGCCACGGGGTCGGGACGATGCCAGACCAGGCTCTACAAGCCGTG
CGTCATCAGCTGTATCCGGCGGTTCCGGAGCTTCGAAGGTGCCGGCGCCACCTGGGAGCCCCATGGAAAAGCTGAACAAT
ATCGCACTTCACTTTGAGACCAAGCTTTTGCCGCAATGCCAAAAATTCATAGCCCAGCCTCCTTCGGATCCCAAGAAAAG
GACAGATGATCATCGCAAGATTTCGGAAACGACCATGCAACAAGTCATTCTCAAGCTTGACGAGGTCAACACAGGTGGTG
ATAGCGCAGTTCGAGCCAGGCGGAAAGAGCTAGTAACTCAAGTACAAGATACTCTCAAGGAAATGGATAGAAAGATGGCG
GACAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62