GenePrediction:GLEAN_5932 Details

Name: GLEAN_5932
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:89758..88668 (- strand)
Length: 1091
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:89758..89738 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_173:89423..89288 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_173:89183..88871 (- strand)
Length: 313
Type: CDS
Source: GLEAN
Position: GCSC_173:88806..88668 (- strand)
Length: 139
>GLEAN_5932 class=GenePrediction position=GCSC_173:89758..88668 (- strand)
ATGTCGAGCTTCGAGTCGGTTGTAAGTATTGAGTCTTTCCGCTGGTGCTTTATCAGATTTCTCGCTCTCGCTCCTCCTCT
TTACACTGCCCATTGGATAGTTGCTGGCTGTAGCAACTAGCATGGCAAGGAAGGCCTGCAAGGCCTCAATGACCGAACAC
GGCTATCGCTGCTTGCTATCTTTGCGAAGGCGAGAGAATTAGGGGTCTATGTCGGGGTGGAAGTCGAGAAACTTTAGGGT
GGCTTTGCAAAGGACAGCATGAGGAGGACCAGGAGCGAGGAGCCATTGTTACGACCTGTCAAAGATCAACGGCTAATTGC
ATGGCATTGTTTTAGGTCGTCATCGATGGCAAGGGCCACCTTCTTGGCCGTCTGGCCAGCATTGTGGCCAAGCAGCTGCT
CAACGGACAGAAGATTGTCATTGTGCGCTGCGAGGCCCTGAACATTTCCGGAGAGTTCTTCCGCGCCAAGCGTACGTCAA
CCTTGTTCCGTGCAAAGTCGACTTCCAGCGATGGGACGAGTTTCAGCAGGACCCGTGACATCAGCATAGCTAACATGTCT
TCTTTCGCATTGCAGTCAAGTACCACTCCTACCTGCGTAAGATGACGCGGTACAACCCGACTCGCGGTGGTCCGTTCCAT
TTCCGGGCACCGTCGCGTATCTTCTACAAGGCTGTCCGTGGTATGATCCCGCACAAGACGTCGCGTGGTGCTGCTGCCCT
TGAGCGCCTCAAGGTCTTCGAGGGTGTCCCGCCCCCGTACGACAAGCAGAAGAAGGTGGTTGTCCCCCAGGCTCTGCGTG
TCCTGAGACTGCAGCCTGGCCGGAAGTACTGTACCGTTGGCCGGTTGAGCCACGAGGTTGGCTGGAAGTACCAGGATGTG
GTTGCCAGGTATGTTACAAAGACCACACGACAGGATGGAGCGATTCCTCTTACTGACACCGTGTGCCTGCAGACTCGAGG
AGCGGAGAAAAGCGAAGGGTGCTGCCTACTACGAGCGCAAGAAGGTCGCTGCACGGCAACTTTCCGAGGCCAAGAAGAAC
GCCAAGGTCGACCCGAAGACGGCCAAGGCTCTGGAGGCCTTTGGATACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62