GenePrediction:GLEAN_5935 Details

Name: GLEAN_5935
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:76213..75888 (- strand)
Length: 326
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:76213..76142 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_173:76103..75888 (- strand)
Length: 216
>GLEAN_5935 class=GenePrediction position=GCSC_173:76213..75888 (- strand)
ATGGTCGCGAAGGCGCAGCAAGATGTGCAGCTTGGATCAGCAGCTCCATTGAACCCGTCCTCTATCGACATCGTAAGTTG
CACCCGACAGGAAGGGAGACTGACAAAAAGCTAGCTGATCTCTGTCGCCACAGCGCCCTCGCAGCAGCCCGACCCAACAA
GGCCAAATGCGAAGGCGTCGGGCGTCTGCTCGGGCATGGCTCCGACCTTCACGCAGACAGTATGATTCCAGTTGCTGCTG
GACCTCCACTGGCAGCAGCGAGTTCCACTATGCCCGTCGTGGCGTCTTTAAGAGCTATCTTACAACACCGACACCTGCTG
GAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62