GenePrediction:GLEAN_5936 Details

Name: GLEAN_5936
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:74250..72456 (- strand)
Length: 1795
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:74250..74134 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_173:74065..73237 (- strand)
Length: 829
Type: CDS
Source: GLEAN
Position: GCSC_173:73156..72456 (- strand)
Length: 701
>GLEAN_5936 class=GenePrediction position=GCSC_173:74250..72456 (- strand)
ATGGGTTTCAAATCTGTCGCACTCTCCACGCTGCTCCTGCTTGGTCAGGCCGCAGCAGCCTCTACCACGGCTTCGGCTTC
GACTGCTTCCACCTCTGTCGAGCCGATTATCATGAAGGTGAGATTCCAGCTCTTCCGACCGTCTGGGCCTTCCGTTGCAC
ATGCTGACTCCCACTCTCTATCTAGGGCACCAAGTTCTTTTTCAAGAACGGCACGCAGTTTTTCCTCAAGGGTGTCGCTT
ACCAGCAGGACACGGGCGCCGCCGGCACCACGACCAGCACCACCTTCATCGATCCTCTCAGCGATGAGTCCAACTGCGAG
CGTGACGTGCCGTTGTTGAAGGCCCTGCACACCAACGTCATCCGCACGTACGCCATCGACCCGACGGCCGACCACAGCGC
CTGCATGAAGCTGCTGGCCGCGGCCGGCATCTACGTCGTCTCTGACCTGAGCGAGCCGTCCAACTCCATCAACCGTGACA
GCCCGGCCTGGAACACGGCCCTGTTCAGCCGCTACAAGGCCGTTGTCGACGAGATGAGCCAGTACGACAACGTCATCGGC
TTCTTTGCCGGCAACGAGGTCACCAACAATGCTACCAACACTGATGCCTCGGCCTACGTCAAGGCTGCCGTCCGCGACAC
CAAGGCCTACATCAACTCCACGGTTTCCCGTTGGATGGGTGTGGGCTATGCCGCCAACGACGACGCTACCATTCGCGACA
AGATGGCCTACTACTTCAACTGTGGCGACCAGGAGAGCGCCATCGACTTCTGGGGCTACAACATCTACGAGTGGTGCGGT
CAGAGCACCTTTGTCAAGTCCGGCTACCAGACGCAGGTTGAGTTCTTCTCCAACTACTCTGTGCCCGTCTTCTTCGCCGA
GTACGGCTGCAACACGCCTAGCGGTGCCGCCGGTCGTATCTGGGAGGAGACCACTGCACTGTACTCGAGCGAGATGACCG
ATGTGATCTCCGGTGGCATTGTCTACATGTACTTTGAGGAGACGAACGACTACGGTAAGTTTTACACCGCCTACTGGTTT
CTCGTCCTATCTCTGTTCTGCATCAATTTTCTAATAAACGGTTCTCCACAATAGGTCTGGTGACCGTTGACGGTACCTCT
GCGTCTACCCTGGCGGGCTACTCCCGACTCAAGTCGGTCATCGCCACGGTCAGCCCCAGCTCCACCGCCATGAGCGCCTA
CACTGCAACCAACAGCCCGGCCTCGTGCCCCACCATTGATGCTTCGTGGAAGGCTTCGGACACTCTGCCGCCCACCCCTG
ACAACACCACGTGTGACTGCATGTACAGCTCGCTGTCCTGCATTCCCGCCACTGGCCTGAACTCGAGTGCCTACGCCGGC
CTGTTCGGCCAGGTCTGTGGCCTGAGCAGCAGCGCCTGCGCTGGTATCAACGGAAACACCAGCACTGGTGTCTACGGTGC
CTACATCATGTGCTCTGCTGAGCAGAAGGTCGCCTACGTGCTGAACGAGTACTACAAGGAGCAGAGCTCTGCTTCCACCG
CTTGCGACTGGGACAGCCAGGCACAGGTTGTCAAGGCAGCCTCCGTTGCTGCGTCCTGCTCTACTCGTCTGGCAGCAGCC
AGCTCTAGCAACAGCTATGCCGCCACTGCCACTGCCAAGGGCACCAGCACCAGCAAGACCACCAGCACCAGCAAGTCGAG
CAGCTCGAGCAAGAGCGCGGCTGCCGGCAACCCGATGCGCAGCTTGGGTGATCTGACTGTTGGTCTGTACGTGGTTGTTG
CCATGCTTGCCGGTGCGAGCATGGTTCTCCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62