GenePrediction:GLEAN_5938 Details

Name: GLEAN_5938
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:63584..60307 (- strand)
Length: 3278
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:63584..63576 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_173:63452..63339 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_173:63239..62287 (- strand)
Length: 953
Type: CDS
Source: GLEAN
Position: GCSC_173:62230..60307 (- strand)
Length: 1924
>GLEAN_5938 class=GenePrediction position=GCSC_173:63584..60307 (- strand)
ATGGATTTTGTACGTTACGAGGCTGCTACGATCTTACGGCGTCGTGTTGTGAGGCTGACACGCTGCCACACTGCTTCGTC
GTCACGTCGTCACGTCGTCATATTTGTCTCTTTTGCTGACATCCCCCCGTAGTGGTCGCGACTGTTAAGCCACTCGCCGC
TTGCGGCTGGCAACTCGAGGAGGGACATTGCCAACGATCCGCACCGGCGGCGTTACCGCTTTGGAAAAGAATACGACAAG
CTCATTGTAAGCATCAGGCATCGATGTGCCCAATGAGGTGCCAATAGCCGTACATTGAGCGGCCAAGATCGCAATCGCGA
GCTGACAGCCTCTCTCCATGTGTAGCAAACATGGCGCAACGCCTCAAACCTCACCCACGAAAACAGCGCTGCTGCCAGTG
TAGCACGCCAGATCCGAGAGCTGACCGACGTCCTGCAAGACGAGTCGCGCCGGCCACTCCCCCACACATGTCTCGGCTTT
TCTGCCGAGTCGCAGATGTACGTGCCGATAGGCAGGATTGCGGCTACATCTCACAACCTAGCCATCATCCAGGAGGCCGT
CTACTTCTTTGGCACCCTGATCGAGAGCGAAGATGAGTCTTTCGTCGAGAACTACACCTTTGCCTCCAGCCTGACGACCC
TCTTTGTGCGTGTCACCGGTACCAATGGCATCCGCCTCGACTCCGAGACCGAGACCAAGGTTGTCGAGCTGGCCTTCAAC
GTCACGACCAAGATCCGCCTCAAGCCAGACATGCTGCCGGCATGGTTCCACACGAACCAGGACCAGAAGCAGCCCCAGCC
GCAGTCTGACGGCGAAAAAGAGCCAAACAGCCACGAGCGGTTCAAGGGAAAGACGCAGCGGCAGGACTTTCCGCTGTTTT
ACATCTTGATGGACTACATCCATTCTGAAGGCAGGGTCGGCGACTTTGCACGGACCGGCCTGCTCTATATCATCGAGGCG
GCTTCGGCCTCGGTCACTCTCGAGCAGTGGATTGTCGAGAGTGACCTCAGCACGCTTATGGCCACCGGCCTCGGCGCGCT
CTACAGTCAGCTGAGCCGCAAACTCGTCATTGACCATCCCTCCAACGGCCTGCCACCCATCCTGGCGCTGTCCGATTACG
AGCATCCACAGACTACGACTGAGATCGTCGGCTCATGCTCCCCCGACTTTCAGGTCCAGCTCGAGACCTTCCTCTCGCAC
CTTCTCTTCTGGCAGGATGTTCTGAATCACTGCCATTCCGTCGAGGTGACGTCGACACTTCTCGAACACTTCCAGGTCAT
ATTTCTGCAGCAGCTCCTGTACGCGGTCTCCTCCCTCCTGTTGTCTCCCCTGTTCTCCCGTCTAACGTCTCCAGATATCC
GTCTCTGCTGGAATCATCCGACATCGACGGTGGCTCGTCCGTGGCCGTCTTGACTTACCTGCGGAGAATTCTCGAGTCCC
TCGACCATCCCGATATGATCAATCTCATTCTTCACTATCTCCTTGCCCTCCCCGATACCTTGGGCGCCGGAAGGTCGGCC
ACCAAGAACGCTGTGAGCGCTGCTCGCAAGCGCAAGTCCATGGACCTTGCCACCATGATGGCAGCCAAGGCTGACCTCAC
TGCCACGCCGATTCTCTTCAACCTGGTCGACCTGATCTTGGCCTGCCTGAAGTCCCACAGCCAGCAGACCATACATGTAA
CCCTGCAGCTTGTCTCTGTTATCCTCCGACGTCATCATCGTCATGCTCTTATGACTCTGCTCCGCACAGAAGCGCTGCCC
GTTGGACCGGGCACACATCGTACCATCGGCGCCCATCAGCAGGAGGTGGAGTTTTTCATGTCCATCGCCGGCTCCATCGG
AGGCCAGGGCAATTTCGACGAGGTGTACGATTGCATCCTGAGGGACACGGTCATTCGGCTGGAAAGCCATCCCTGTTCGC
TAAAGCTCATCGCCCCCAAGGTCTCCGCCAATAGCCACGAGCTTCCAGCCATTCCAGACAGCCTCCCTGGTGCGCCTCGT
GACGTTTCTCGGCACACCATCCGCGCCGAGGACCCTCTGCTCAACACTGTCATCGATCGGCTCGAGACCTTTTTCATCAA
TCCTATTGACACCAATCTGTCTCTGACAGAAGCTATTCTTGACCTTGCTACCTGCGGCTTTGTAGCTTTGGAGGGCTGGC
TAATTCGTCAACCAGACAAATACGTGTTCGCTGACAACGAGGATACCACGCCTTCCATTGACAATTGCGACTTGGATTCG
AACTCTGCTGCATTTGCTGATCTCGGCGGACCTCTGGCCATCAAAAACTGCCGGCGACGCCCAGCCTGGACCGGCCTTCC
GCGTCTTTTGTCCGTGCTGCAGGCGCAGTTGGACCATGTTACTGCCTATCATCGTTCCATTCCTCGGTTCGGCGATCTCC
TTCAGGGACGACGTGACGCATTTCAGGCAGCAGATTCGGCCGGGTCACAAGCCGCGCCATTTCCCAAATATTACAAGAAC
AGTAACCAGACCACACCGGTCGTTGATCGCACCAGCATCGACGGCCAGAGGAGTGGCTCGCCGGTCCGTCTGTCTGCACT
CGAAGGCTTTGCGCAGCGCATCTTTTCAGAACTGGGCACTCCGAGCCGGTCCGCGAGCCCTCGGGGCAGAAAAGACCCCA
ACAGAGCTACCATCTCTGCTATCGCTGTTGGCGGGAGCAGTGGCATTGGCGGAAGTGGAGGCAGTAGTGTCGGTGTCTCC
AGCGGCTACGGGTTTGCTACGCCCACCCCGACGAGGCCCGTAGGTCCTCCCCCTAAGGAGTTTCCGCTCGCTGTGGACAA
CACGTCACGAAGGGCCAGCGGTCCTGCCAGGCCGTATTCGTCGAACAGCCAGCGGGGGGAGACCGGGTTGTCAGACGGTC
GGGATGGCACAATTGCGAGTCAGGTGGTAGCTTTCCAGGCCGTAGACCGCACAATACTTGCACGTCGCGTGGGCATTCCG
CCTGCTAAGAATCCTGTGGCACCCATACCTCTCAACTTTAACAAACAGCCCCAACCCCAACCAGATGCGACAGACTCCAA
GAAAGATGACGACAGTCATGGGGACAGTTCGGACGATGCCACTGATGACAGTGTGAAGACAGGCGACGACAGCGAAATGC
CGGGGGTCGGGCTTTCTGCGGAGGAGGACGACGAAGAAAAGACCGTCACGGTTTCTCACATTCTTACCAACACGGTGATC
CTTCAGTCTTTTTCGCTTGAACTGGCGGCGTTGCTGCAGGCGAGAGCCGGTCTCTTTGACGAAGTGCGATTTGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62