GenePrediction:GLEAN_5939 Details

Name: GLEAN_5939
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:54482..53208 (- strand)
Length: 1275
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:54482..53676 (- strand)
Length: 807
Type: CDS
Source: GLEAN
Position: GCSC_173:53555..53208 (- strand)
Length: 348
>GLEAN_5939 class=GenePrediction position=GCSC_173:54482..53208 (- strand)
ATGTCCAGTGAGACACCGTCGAGCGCCGGAGGCGTAGCGTCCTCCCAGTCGCTGCTGCCGACCTCGTACGCGAAGCCGTT
TGTTATGCGCAATGGCCGAACGTATCTGTCGAACCCTTCTCTCTCCTACCCCCTTCCCGTCGACCTCGCCGAGCTGCACC
GCCAGTCCTTGCGGACTCTTGTTCTTTTTCAGCTATTCGGTGGCCCTGTGTGCTCGCCTGCCTTGGCCAACAAGCCCCCG
ACTCGCGTGCTGGAGGTTGGCTGCGGCTCTGGCTTTTGGAGCACTATGTGCAACGAGTACTACTCGCGCCAAGGCCACCG
TGGCATCTCGTTTTCAGGCATGGACATTGCTCCCGTCGGCCTCGGCGCCAGCAGCGCTGCTGGCAAGAGCCGCTCAAGTT
ACATGTCGTCCTCGTCACGCGGTACTTCCGGCTCTGCCGACGGAAAGCCCGCCCCAAGCAAGAGCGAGGATCACATGAAT
TGGCGATTTGTTCAGCACGACATGCGACGCATGCCATGGCCCTTCCCCAACGAAGAGTTCGACTTCATCATGGTCAAGGA
CTTGTCTCTAGCCATGCGCATAGACATGTACCAGCTTGTGATCGACGAATGCATTCGCCTGCTGCAGCCTGGCGGCACTC
TCGAGTTGTGGGATTCGGATCATACCATCCGCATGCTCCGCCCCCATGTGCCCGAGACGTCGCCTACGCCCTCTGGCGAA
GAGGACAGCCACGATGCTGCTATTAGTGCCGGTGCCTATATCATGACCCCGCATACGCCCCTCTCCGCCCCGCTGAACAA
CTATCTTGTCGAATACAATGCATGGCTAGCCAAAGCGCTCGAAGCAAGATCGTTGCCGCATATCCCCTGCACAATAGTTG
GCGCTATGTTTCTGCAAGAGGCCGATGCTCTGGTTGGCGTGGAATAGCTCCGTCTTGCCGTGCCATTGTCCGAGCTGAAA
TGGGAGCGGGAGGGTGTCGGCGGTGTTGTCACAAAGGATGGCAAGATTTATGTCGAGACGAAGGGAAAGGCCCGGGACGC
ACATCCAAACCGAAAGACAATCACGGCAGCACAGAGCGCGCTGCGACGCACTGCCCTCCTCACGGTCGTGCAGATGATCC
AGAGCCTCGAACCCATACTGCGGGAGGTGAGCGGAAAGAGCCAGGATGAATGGGACGGTTGGTCTGGCAAGATGGTGAAT
GAATTGATGAAAGAGAACGGCACTGCTTGGGGAGAGTGTCTTGAGATCGGCGCTTGGTGGGCACAGAAGAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62