GenePrediction:GLEAN_5940 Details

Name: GLEAN_5940
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:52173..51089 (- strand)
Length: 1085
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:52173..51796 (- strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_173:51728..51558 (- strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_173:51460..51089 (- strand)
Length: 372
>GLEAN_5940 class=GenePrediction position=GCSC_173:52173..51089 (- strand)
ATGCTGGCTCTCCGACGACGTAACTGGGCCGTGGGAGCGGCGTGGCTTGCAAACGTATTACGTTCCCAGGCAAGCAGCTC
TCCGACGGCATCCCGGCTGCGTTTAGGTCCGGCATACTCAACAGCAGGAGTTGCTACTTCAGAAGATTCGGCTGTCCCGC
CTCTCCCACCAGCTCGTTGGTTGTCCGATCTGCGAACGCGCATCGGGAAGTGCATCATCTTCGGATGCACCCAGTCGCAA
ATTCGCGAAGCTGCCGGTGTCCTTCGGGTTCTCGCCACCGAATGGCGGCAATTGACTGCTGGCAGTGAGGGTTTCCTCAC
AGGACCCCGACGAGGACTAGAGGGACAGAAAGTGGCCTGGGGTGAGATGGACTCATTCGTACGTAGATCCCGAGCACGTT
CGCTACCAAGCAGATAGAGCGATGCCATTTCTAACTAGAGCGCAGGGCCATGTCAACAACGTGATCTACAGCCGATATGC
CGAAACAGCACGGGTGAACTGGGTGGTGAACTTCGCTGTTCGGGTGGACCCAGCGCATGGCACTTTGTGGTCTGGACTGA
TGTCGACGCGTTCGGTGGGCTTGATTATGAAGAGCCTCAAGACGGAGTTCAAGTTTGTAGGTCCTGGCCCAGCATGGCGA
TAGTGAGGCTACAGAAAAGCTCGCAAAACCAGACCTTATGGTAGGAGCTGAGCTGACAGATGCCTTTTACCAGCCCATGA
CTTATCCAGACAGCATTTCCGTATACCACAAGCTCAGAGTGCCCCCGGCCACCAATTCAACGTCGACATCGCTGCTTCTC
GACTGCATGGTGCTGTCACATCGTCAAATGAGGATTGCGGCAAGGACATTTGAGGATATCGCGATCTACGACTATAGAGT
GGCCAGGAAGACAGAGATGCCCGAGTTTATGCACAATGTATTAGTTGATGTATGGAGGCAACAGCAAGACGAGACGGTAC
GTGCACGCACAAGGATATGGGAGCTGGCCAGGGCAGTTGAGCAGCTAGAGAAGAAAACTTGGGACCGACCTGACGCAGTG
GAGGATGTTGGAAGCGCCGCAGGAGGGACGGCCATCATGTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62