GenePrediction:GLEAN_5941 Details

Name: GLEAN_5941
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:48721..43724 (- strand)
Length: 4998
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:48721..47556 (- strand)
Length: 1166
Type: CDS
Source: GLEAN
Position: GCSC_173:47168..45121 (- strand)
Length: 2048
Type: CDS
Source: GLEAN
Position: GCSC_173:44777..44723 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_173:44483..43724 (- strand)
Length: 760
>GLEAN_5941 class=GenePrediction position=GCSC_173:48721..43724 (- strand)
ATGCCTCGCGCCTCGCCCTCGGCCAAGCGACAGCCGGGAGCAGCGAGCCATCGCAACACCCAGCATGAGAATGGCCTCCT
AGGCTCTGGAAGACGATCTGGCAAGCACGTACATCAGCACCAGCACCAGCAGAAGGCCTCCTCGGCGGTGACTGCTGATA
ATCTTGTGCGGCCGTCGCCACCCGATTTCCGTCCTGCTGTCTCGTCTACTCTATCCGCACATTCCCCGCCTCAGCTATCC
TCCAGCGCCTCCGAGGCCAGCACGTACCTCGTAACGGACAGCGACACTATGGCTGCCCCTCAGGAAAGCTATCATGGCGT
GGAGTCTGGTAGTAACGGGGACTTGCGGCGCCTGAATGGCGATCGACGGTCATCTTTGGACAATGCGTCATCGGCATCCT
CAACTGACTCCTTCAGTGCAAATCCACAGCCAGCCATGACGCTGGCCGCGACCTCTGCCAACAATAACATGCCTTCCGCC
CATACGTTGTTCGATGAGAGCCACCGCCGGATCGACGTGAACGCCGCAAAAAACGCAAATGTCCATCGCGACACTGGCCC
CTTGAAGCTGGCTGTGACCGTTCTGCGATCCTGTCCTCTCTACGATACGCTTGCGATCCTCATCATCTTGATGCAGCTTT
CCCCTGTTGCACTTTCCAGCATCTACATGCTTTTCACAGTGCTTACATTCGTCCCGCCAGTCACCACCAGCTCTGGCCTC
AGCATCACGGAGATTTTCGAAGGCACGTTGGGTACACCGGCTTTGATGACCGTGGCGTGCATGGATGTGGGATTCCTGCT
GGTCTGGCTGTTTCTTTGGGGTCCTCTCCAGCAGCTCATTCTCGACTTTGCTCAGATCGTGATCGCACTCACCCTCGGAG
GTGGCGGTGGCAGTGGGAGTTCCCGGCAGGGCTCAGCAAATAACATATTCATGTGCGTTGGCATCGTGTTTTTCTCGCAT
TTTGGACACATCCCGGTCCTGCAGAAGCTGGCTCGTCTCGGCCCGTTCTTCACTACAGATCCTCCGTCTGCCCAAGCAGA
AAGTTCGGCAAACTTCCAGCAGACGGCAAAGCTCTTTGGTCGTCGTGGGGGGGGTGTCTCATGGCTTCGAAATATCTTCG
CTATCCACATACTCACCCAGGGTATCGTCCGCTGCATCCGCGAATGGTATTTAAGGAGAGAGAAACGCGACTTAATGGCG
CAAAGCATGGCCGACCCCGAAGCTGGAAAAAGTATGTTTTCTACAGATATGCCAGCCGACACTAGCTTCGGCATATCGGA
TGCAGTCGTCGGCAGCGCTACGAATAGCAATGGTGGTGGCAATGGCGGTGGCGGTGGCAACAGCAATGGCAACGGAAGTA
TCGGCAACAACTCCAACGGTAACGCCAATACCAACAATATGGCTATGAGCAATAGCATAAGCAACACCGGCAGCAGCAGC
GGCACCAGTAACAACATTGGCAATAGCAGCAACGCTGATACTGGCAGCCATGGCGTGGTCACAAACCTCACCCTCGCCGA
CAACACTAGCCTCAACAGCAACAGCACGGGCAGTGTCAATGCCGCAGCCGGCCTCTCTGGTGGCATCCATGGAGTCAATT
CAGCTTATGCGGGTAGTATTGGGCCCAATGGAGCTCAGAGCGTGGGATCTGCGGTCTTGTCCAACACCCCGAATATCTCC
AGCAGCGGCAATGCTTTGGCTGTCACAGGGCCCGTCTCGGCCAAAAAAAAGAAAAAACAGAGTGCACTGGTGCGCCTGCG
CCAACCTCTCTGGGCAGCCCTAGCCAGCACAAAAATTGTTATGATCAAGGAATATGAACTCTCGCAAGCCGCATTAGAAT
CTGCGGGCGCCGAAGCTACAGATGTGGATAACTTGGGCAATGCACCTTTTTACACACAGCCCTTCCAGATCTGGATCTGC
TATGTTGGCCATGATGAGGTATGCTTTAGCACCAGCGTGTTCCCAGACGACAAGTCGGGCCAGGACCAACTGTCTCCAAG
CTCTTCCTATGTCGATGCTACGAAGCCATTCTTTGTGCGAATCAACAACGCCACATGGCAACCGACACGAATTATGGCAA
TTCCTGATTCGGATGACGACGTCGTGCCAAATTCGACTGAAGACACGAGAAACATCCCTTTAGTAATGGGGACGCGATGG
ACTGGTGACATATATGGCCTCACTCCCCTGTCCAGCTATGAGTGTGAGTTTGTCAGTATTCGAAACGGCGATGTTCTTTT
CAGCACAAGTGTCAGGACAGCACCGGCCCCGTCGCGGAGCGCCGATGTGACAGCAGCCAAGGCGATGCCGCCCAGTCAGC
CGCGGCCGCACGAGTCTCCTGCCACAACAATCAAGGCGTCTATTGCAGCTCAAGAAGCCAAGCTGCACGACGAAAAGACA
CGACTCAAGACCTTACGGAAGGACAATAACCGCCGTGTGAATGCAATAAAGAAGGAGATTGATCGCCTCATATCGTCTGT
GCAGTCCGCTGGTGGCAATGACGAAAAGTTGAAGCAGAAGATCACACAGAATACAGTGCAGCAGAAACAGGCTGAGCAGA
CTATCGAAAGCTTGGAAGCAGAGCTCCGGGAAATCAGCGTCGTGCCCGAAGATCTACTTAGCCGTCACCGGAGCAAGAAG
AGCGAGTGGGATCGGGAGAGGGCGCTCTTCGACGGTGCTGTGGCCTCATTCAAAAGCTTCAAGAGCGCTGTCGACAGTGA
GGTGCGCGCATTGGAAGAAGAACAAGGAAGCTTGCAGGCCAAGAGAAATAAGATTGCGTCTCGTATTGCTAAGGCTGACA
GTGATCACGCCCGTATCATGGATGCCAACACACAAGGCTTGGATGAGGTGGAGAGGAGAAAGCAGGAGCGCGCCTCGATA
AAGAGCGACATACTGCTAGCAAGCCGCAACTATATCGACCGCATTGCTGCAATCCAGGCTAGCAACGAGGAAAAGGTGCA
TGCTATCGACGCCATGCATGAGGCGATGCGCTCCTTCTACTCCTCCTTCGACAGCGAGCGTCCCTACGAAGACCGACATA
TGCCGGTTCTCTCATTGCCAGCTGCAACATCTAATTCCAACGCTAGTGCGGCCTCGGGCACCTGGACATCCCATCAAACA
GGCGCTGTGTATACCCTCGGGTCCTTGTGGCCAGTGATGTCAGGCGTGCCGGCATCTGGGCAATCTCCGCTTCCAGCCCA
CATTGCTCCAGTGCCGCCGTACATGCAAATGCCGGCAATACATGCCGGTGGATACGCCCAGCTGCCGAAGATGCGTGGCC
GATCCTCATCTATGCTGAGCGACGTTTCCGGTTTCACACAGTCCAGCGCCGCAGACGAAGATGTCGCCGTACCAGTCAGC
TCTTGCGTTCGGAAGGCGAGTGTTTCCAGCCCCACGGCTATCCACTCGATGCAGCCACCTCTCGCCGTCACGTTGCAGGA
GCCAATTGAGCTTAGCATTGATGCCACTCGACGCAGCTCTGGTTCGGGAACTGGATCTGGATCCGGGTCTGGTTCTGGAT
CTGGATCGGGATCTGGTTCTGGTTCTGGCAGCAGTGTCCGCAGTGGAAGTGAAAGTGTCGACAGTGTCCACGACCCAGCA
AGTCCGTTATGAGGAGGGCTGGAGAGGCACAATTGGTGTTGCTCGCTAGTCCCGACCAGTTTACTTTCAGTGTCTGTTCA
AATAGCTTGTTGCGAACCAATTAGCAGATGGCGATCGGTAGGCCTCACCATAGCGCTCAAGATGTTATGTTACCGCATTT
TCATCGTTTTCCTCTTCCGTAGTACTAGCTGCTGTACTCCGTACTCCGGATGCATTGTGCCTTTCCCAGCTCCGGGGTTA
TCCGCGTTATCTTTACCGTCGGGCCCACTTGCCATTATAGCGCACCTTTTTTTCTAAGGTTCACTCCAGATCCGACAGAA
CACAGCCTGCTCGTCCCTTCACAGTGCATGGGACACCTGGCCATGCCGTGTTTGTGCATACCATCTCGTTTATTTCGAGG
TAATGATGTCAGGTTTGGTTTGACGAATCGGACGGTGGCCCAGCTATTTAGCCTCGATTGCAATTCATATGTCGCGACAG
ATACGCCCCTAAAAGCAGGCATAACTCAACTCTCTATACTTTCCTGGCACACTGAGGCTCGGTATGCCAGGCCTAGCCAA
CTCCCGATGGGCGTTGAAAGACGGCCGATCAAGCTCTGTGCCAGCCCCTTCCTCCCGCAGTCCAACAACGACTGATAGAA
CGGGATCGGGCGAGAACGAACCTGTACCTGCTAGCAGACCACCGGGCCACAACGCGTCCGCCGCCGCGGCTGCCCGCGAG
CTCTCCCGCTACTCCATGATCGTCCGCCGGATGAAGTGGAAGCTTCCATTTCTAGGTTGGGCCTATCGTCAGGCGACTGG
CGATGATGATACTGCGGAGGCAGAGATGATGTTCAAGTTGGACTTTTTTGAGTACTACATGCTATGCGAGCGCGCTCTCG
TCCACCTGCAGGGTGTTTTTGGCATCACCATTTCCCGGGATACAGGATTGGGGCCAAGAACAACCGTCATAGGCAGGGGG
GGTGCTCCAATACATCGCTACCATGCGAATGTGCTAGAAGCCCTAGATCGCGAAGACAACCCTCTCCATGTAGCTCTGGG
TGCCGGGGATGTACGCCGGCAGTTGGCCAGGGCCAAAGAGCTCCGAAACCGGTGGAAGAAGGTTGGCAGCGAACCTGACG
GTGACTCCAGCGCGGCGGACAGCGGACGGGGAGGCAAAATAAAGACGCCACCACTTGCTACGTATGATCTGTCTGGAATA
TTAGCCTCCATTCACCAAGGGCTCGACCATGCCTTTGGCATTGCCGACAGCTTTGTCACTGCTGAAGCTGCAAACTCCAG
CGGCGGTGGCATGGAGAAAAGTGAAAGTGGCCAACTTCGTATGGAAGTGGATTTGGATATCACGGAAGAGGAGCGGTGGG
TTTTTATGGCAGAGGCTATGGACTGGGAGGCTGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62