GenePrediction:GLEAN_5943 Details

Name: GLEAN_5943
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:40775..38288 (- strand)
Length: 2488
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:40775..39462 (- strand)
Length: 1314
Type: CDS
Source: GLEAN
Position: GCSC_173:39394..38915 (- strand)
Length: 480
Type: CDS
Source: GLEAN
Position: GCSC_173:38557..38288 (- strand)
Length: 270
>GLEAN_5943 class=GenePrediction position=GCSC_173:40775..38288 (- strand)
ATGCGAACGACGACAACGCCTAGCTTTCGCCGCCACATCCGTCCCGACACACAGACGCCCGTCATCATCCCGTTCCTCAC
CATGTCAACCGCCGTCAAGCGTGCCTGTGACGCCTGCCACCGTCGCAAGGTCAAGTGCGATGGCATAAACCCCTGCCGCA
ACTGCTCCTCTGCCCAGCTCTCTTGCACCTACAATGCCATTCCTCAGAAGAAGGGTCCCAAGGGCTCTCGCGCCAAGGTC
ATCAGCGAGCTGCGTGAGACGCAACGCCAGTCGAGTCTGTCCGCCAAGATCCACAGCCGTATGAATGGCAGCATTGCCCC
CTCAGCCGCAACGCTCGCCCCAACACCTGGGCTTCTCACGAATGAGATAGTCAGGGCCTGTGTCGACTTCTTTTTCGCCA
ACATGTATCCGGCCATGCCTATTCTTAACCGCCAGCGCCTTGAACAGGATGCCATGGCCACAGACACCACATTCGACACT
TACTGCTTGCTGTCATCGCTCAGTGCATTCATGATGCTGCAGCCCGGCATGTTTATCCCCGGGGTGGATCCCCATGGACC
AGAGGGTCTACCTGGAGCCACTATCGTCACGGCCACGCTGCTTCTGGATGAGACCATCCGCGTGCGCAAGGGCTACGACT
ATCTTCAGAATCCCAATCTGTATACGCTTGCCACTAGCTATTTTCTGTTCGGCAGCTACTATGGCCTGGAGATGCAGGGC
AAGGCTTGGCTCAGCCTTCGGGAGGCCACGAGCCTAGTCCACCTAGTGCGCATGAACAAGGAGGAGTCGTATCTTTCCTG
GGACAACGTCGAGGCGTCGTGCCGCCGGCGCCTGTACTGGCTACTCTTTGTGGCCGAGCGGGCATATGCGCTACAGCATG
GCCGCCCGCTGTCACTCAAGGCGTGCATTAACCCCCCGTCCTCGGCCGAGAACCCCGGTCTCCCTCTTTCTCACCAACTC
ATTGGCTTCTGTCGGCTAGTCGCCATGTTCCGCCCCTTCGACGACTCCTTCGTCGACCTCTGGAACAAGACGCGCGCCGA
ATGCGTGCCGTCCTACATTGCCTCTCTCAGAAAACAACACGCCGATGTTATGACAACCTTGGCTTCTGCCGACCCTCAAC
TCAGCGACGTGGTGCTAAATCAACGGTGGCTCCAGGCTCTGGCCTGGCAGATCAATCTGACCAACGGCAACGGAGTGTCC
CATGGCAACGAAGCCAACTATCAGTACTCCATGGTGGATGTGTCTCGTGAAATCGTCCCCATGGCGGCGGCATTTTCCGC
GCCTGGCAACACCAGCTTGCTGGGCTCCGGACTGGTATGTTCTGCACTATAGCCTCTATATGTGGTATATTCTGACATAT
TTGCTCCTCTGTGATTGCTAGATCGAGACCCTCCTCATGATCACGAGCGATCTCACCGATGTTCTCTCCTTGCTTCCCTC
TTCCAGTAACCCATTCGCCACTGGTCCTGGCGAATATATGGATCAGCTGTTGAGCATTTTGGCTATGCTGCGTGTTGGCG
AACATCGCTTTGCTCCTCTGCTTCTAGCCAAGGTGCACGAAATTCTCCCTCGTCTTGCCAACCCAATGCTCCAGAGTCCT
CCCGAAGCCGCTTGCGAAATGGACATTTTCGATGGCTTTGGCAGTGCAGGTATGGCGCAGCCTCCTTGTTTGAACATGGA
CGAGTATAAAGTAGAAGGACCGAGCTCCACTGCCACGTCTCTGCGTGACGTGAACACACCTTTCACATCGTCGCCTCCTA
TACTGTCGCCGGGCATGGATTTTGCCCATGACTTTGTTCCCATTTCCGACATGGTATTGCAACGTCCGCTTATTGCCAAC
ACCATTTCCCCTGTGTCTCATGTGAGAGGGGCCAGCAACTCTCACAGGACTCCACTGCAGCTGCAGATGCCTTCACAGAT
GCAGCAGCCGCCATCGTCACAGTCGCCACAGCAGCAATCCCAGCAGCAACCTCAGCAGCAACAGCATCAACATCAGCACC
ACCAACAACACCAACTTCACCACCACAAGCATGCCCAGTTTTCTCAATTGCAGATCTCGCACCAAAAGGTGTCTCAACAG
CAGCAACAGCTTCAGCAGCAGCGCTCGCCCGTGTCCGTTATGCGATGTCTGAACCAAAGCTTGGGTGGTAGTACTCAGAT
GCAGCATATTCGGATGAATCACGGTTTGAATATGACGAATATTGGTGTGTCTGGCCAGCGCATCGAGCCGGCTGAGAGCT
TAGCCGGTGTTTTGGGCGGTCAGGCCTTTGGTAGGCCTGTGAATGATATACATACGGGATTAAACACAGGTGATCTTAAC
GGTTGCCATGAGCCCCAGCGGCACAGCAGTTTTGCGGTACCTTCACAGCAATTTCGAGCAGTGGAAGATTATCAGATCCT
GCGACGTGAGAGTGGTGATATAAACTCTCTTGGCGGCCTAGACATGAACAGTCTCCGCACGGAGATGGACTTTGGTGCTT
TGAGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62