GenePrediction:GLEAN_5948 Details

Name: GLEAN_5948
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:916507..914987 (- strand)
Length: 1521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:916507..916410 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_82:916334..915141 (- strand)
Length: 1194
Type: CDS
Source: GLEAN
Position: GCSC_82:915068..914987 (- strand)
Length: 82
>GLEAN_5948 class=GenePrediction position=GCSC_82:916507..914987 (- strand)
ATGGCGCCGAAACACCATATTAATGGCCACGCGCCTAACCTTGAATCCTACTTCAACTCGAAGTTACATTTGGAGGCGTC
CGTCGAGACAGCTGTGACGTATGGGCCGGCCCACTCGACCTCCTGATTGTTTGACATGCATACTGACGGTGTTTTTCTGC
GCCCGGGGGGTAGACTTTTGAAGAGGCGACAAATACATGGCCCAGAGCAATGTGCTCTTGCAACTGCGCACATTCTCTCG
CAGGTGGTTGTCAAGTCAAAATGGGCCGATGTTGACCAGCTGCTAGATCGTGTGTATCAGGTTGGACGGAAGTTAGTCGA
TGCACAGCCGCAGGAGCTGGTCATCGGTAACATCATTCGACGGGTTCTAGGCCTTATCAGAGACGAAGCTGAAGAAGACC
GGAACGAAAACGCCAACGAAACTGGTGGAGACTTCGTTCCAGATCTGCGCACGGCGGCAACCACAGCAGCAGCGACATCT
CTTTCGTTTTCTGCTTCCCCAACTTCAGCGCACGCTCCAATTTCTTCTTCTCTACCACGACCTTCGCGCCAAGCGTCCCT
TGTGCCAGCCTCGGGCTCGTACCAGTCCATGTTTAACCTTCTATCTGCGGCGGAGCCGTCGCCTTCAGTTGGCGGAGATG
CGAGTTCGACTGTCTCGGGTGCATCAACACCTGTGCATCTTGCCTCAGGCCAAGGTCATGGCAGCGCGGTCAATTTTGCT
GGGAGACATAGCGCTCTCAGGGACGAGATTGTGGACGGTATAGAAGAAATCAAAGACGAGATTGGCCAAGCGGATGACCA
GATCGCCGGCTTTGCTGAAGGGCAGATTAAGCCAGGCGACTTTGTGATGGTCTATGCACCCTCCCGATCAGTAGAAAAGT
TTCTGGTCAAAGCGGCGTTGCGACGGCGATACACGCTGTTCTTGGTGAACGACAATAGTCCGACACATTCCTCTACTGGA
CTTCAGGCTGTTGGCGAGCGCTACGCGTCTCTTCTGAAGCGGTTGAGTGCAGCAAAAGTCAATGTCATACGGGTAGCCAA
CAACGCTGTGGCCTCTTACATTCCCCGGACAAGCAAAATTGTGCTCGACGCACGAGCCATCGCAGCCGACGGCGGCGTTC
TTGTCGACAGCGGAGGAGGGCGGGTTGCTCGAGCGGCCCACGCCCAGGGCTGCACAGTTCTTGTTGTGGGCGGCGTGTAT
AAGGTTTCCCCAGAGTCCTGGACGGATCCGGATGCATTTGTAGAATGGGGAGATCCAGGCAGGCTTGCTCGCTTTGCGGA
CGGTGCAATTTTGGACGGCATCAAAATCGAATCTGCAATGACGGAATACCTACCTCCCGGCCTGATTGACATTTACGTAA
CCAATTTGTATGCTTCTATCCAGCCTTAAAGTCCCTCGACAAGAAAGCTGTGTTTGCGCTAACTAACGATTTCTTGCAGA
GGGCCGCATTCAAAACACTATCTCGAAAGCGTAATTGCAGACCACTACAAAAATGAGGATTTGGAGCTATACGGACAGTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62