GenePrediction:GLEAN_594 Details

Name: GLEAN_594
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:822719..824719 (+ strand)
Length: 2001
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:822719..822967 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_97:823043..823510 (+ strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_97:823670..824719 (+ strand)
Length: 1050
>GLEAN_594 class=GenePrediction position=GCSC_97:822719..824719 (+ strand)
ATGCCTGCCACCCTGGCGGTCGAGAGCTCGTGGCGGATGGTGGACGGCGAGCACGACAGCTTCGACACGTCGGTCGTGCC
CCTCGAGGACGACCTGTTTCTTTCGAGCGGCCAGCCGTCGCAGGAGTCGCAGGAGTCACAGGAGTCGCAGGACGACGACA
TCCAGACGTTTCTGCGCCGCGCTGAGGATGACGACGACGACCCGCGCGTGCTGCTGCGGTCGCCCTTCCAACCGTCGCTG
CCGTCGTCGGTGCGGCAGAGCCCGCTGGCCAGCGGCTGCAGCGGCCACAGCAGCAGCAGCAGGACCGACCGCCTCGACCA
CCAGGCTTATCGCACGCCTGAGCCGGAGTTCCACATGCCCAGTGTGGATGTGGGCGTCAATCACAGGGGCAGTCCTGCAC
AGAGAGACAGGCCGTCTAGCCACTGCAGCAATCAGACCGTTTTAACCGCAGCTACAGCAACTAACGCCACTACTAAAACT
ACTACAATTACCACAGCTAAAACTACAACTACAACCTCGTCACCCAAAACCACTCTTCGCCTCCCGTCTGTCGCCCTCTT
CGTCGCCGTCCTCGTCGGCTGCGGCACCCTCTTTGGGCCCGGGGGGCCAGCCAACAGCACGGCGCGGTCAATCTACGCAG
AGGCCGTGGTGCCCACGTGCAGCATCCCGGCCGTAGCCTGGCTCAACCTGGACGTCTGTGCCCCGGCAAGAACTGTAGCT
GAGTCAAGGGCGGGTCCGGCGCTGGTTGAGAACGCCATCGACAACTCGACCACCCACGACGACGACAGAAGGGTTGGCGT
TCGCAAGAGCGGTCCTACGTGGAGGCCCCGTGGCAGCCAGGACACGAGCAGCAGCAGCAGCAGCACCGACAGAACCAGCA
GGACCAGCAGAACCAGCAGAACCGACTCCGGCAGTCTCTCACGCGATGCTAGCAAACTGATGCGCGTGCAGACACAAGTG
GCGGCCGTGGTGCGCGACCATGTGGCGGCAAGCCAGGCATCTGGCGGGACGACCGCCCAGGAGACGTGGCTGCTGGCGCG
GGCACGCACCAAAGACCTGAGGTTGGCCCTGCAGGCGGCCCAAAGCCGGCGATCGACGGCGGCGGTGATGGCACCATCAT
CGGCCGTGCCACCGTCAACGTCGACGCCATTACCCAGTCGTGAGGCGCTCCTGCTGCTGGAGCTGGACGAGTACCTGGAG
GCAGCCAAGGGGGTATCGTTGGCGCTGGCGCGCTTCCAGACCGGCGCGGGGGCGATGGCAGCTGACACGTTGGCACACGC
GACGCGGCGGACGCTGGTGCAGCTGCGACGGATGGGACAGACGGGCAAGGTGGGAAGGATAGAGGGAGAGGGCGAGATGG
AAGGAGAGGAGAGCTGGCTGCCACGGATGTTGAGGCTTGGCTCTTCGGGCTCGTCCGCCAGGAAGAGGTCTGGCAGCAGC
AGCAGCCGGCACGCCCTGGTCGAAGCGTACCGGCGACACGCAAACACGCTGGTGACGAAGACGGGCTGCCGGGTGAACGA
GGCCGAGGCGGTACTGACAGCTCTCGAGGCAGCGGGCATGCATCTGGAGGCGGTGCAGGCAGTAGTGGCGGGTCGACTCG
ACGAGCTGACAGGGGTGTCTCGGGCGGAGGCAACCGGCCCAGACCGAGACCGAGACCGAGAAGCAGACACAGACGCAAAC
GTGCTCTGGCGGTTGCTGGGAGCCATGCTTCGGAGTGCGGTCGGATCGGCGACCGACAAGGCGTCCCGGGCTCTTCAGCA
GTGGGAAGAACACGCGGCACAGCTGCAGACGGTGCGGGAGCGACACGACGCGACGGTGCGGCAGACGAGCAAGGTGCTAG
ACGAGCTGGCAAGCCTGCGAGGCACGCTGCAGCAGCTGCAGGGTCGGTTTGCGGGAGAGGACTCAAGGCCAGATTTGGGG
CACTTGGGACTGGACTTGCGGCTGCACATGGACATTATCGAGGCGGGGATCGAGGATCTGGAGATGGTGTACAGAGGGTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62