GenePrediction:GLEAN_5950 Details

Name: GLEAN_5950
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:899195..898019 (- strand)
Length: 1177
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:899195..899005 (- strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_82:898933..898914 (- strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_82:898860..898393 (- strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_82:898308..898019 (- strand)
Length: 290
>GLEAN_5950 class=GenePrediction position=GCSC_82:899195..898019 (- strand)
ATGACGATGTGCAGAAAATCGGTCCTCGTCACAGGCGCATCAGGCCTTCTAGGCCGGCAAGTCGTAGAGGTTTTCGAGCA
AAGCAATTGGGCTGTGACCGGCACTGGCTTCTCCCGAGCAAATGGCAAAACCTTGATCAAGGTTAACCTGGAAAATTCGA
CCGAGGTGAAAAGCGCCCTCGATGAAGTGAAGTACACAATTCTACATGCTTCCAACACGTACGCACATTTAAAGCCCAAG
CAAATACTGATTGGTAGCATAGGCCAGATGTTGTCGTTCACTGTATGACAGTTTGCGCAATCGACGAGGAATCATGTTTT
GCTAACGGCCGACAGGTGCGGCCAACCGCTTCCCCGACAAGGTCGAAAATGATCCCGAAGGTACACGCCGCCTCAATATT
GAGGCATCCAGGAAACTAGCTCAGCTGTGCGCATCCCGTGGGATCACACTAATCTACATATCCACCGATTACGTCTTTCC
CGGCAAGCCTGGCGAGGCACCGTACGAGGTTGAAGCAGCACCGGCGCCAACGAATTTGTATGGACAGACAAAGTTGGACG
GTGAGAGGGCCGTCCTTGGTGTCTACAACGAAGCACAGCAACTGGAAAAGACGAAGAAGGGTCATGCAGTTATTCTGCGA
GTTCCGGTGCTGTATGGCCGGGTAGAGAAGCCGGCTGAGAGCGCCATCAATGTACTCATGGACATTGTGAACAAGGTGCA
AGCGGAAGGGGTCACAGTGAAGATGGACGACTGGTCGATCCGCTATCCGACAAATACGGAAGATGTGGCGCGTGTCCTGA
AAGGTAAATCCCTTTAATTGGTAGCGCAGAGAACTCGAAAATAATAGTCTTGGTAAAGCCCGTTTTATCTCTCACTGACC
TCGCTAGATATCGCTACCAAGTATACCGAAGCAGTTGATGCCGACCTGCCACCGGTTTTACAGTTTTCGAGCGAGGATCG
GTTTACCAAATACGAGATTTGCCGACTCTTTGCGGAGACATTGGGTGTTAACATTGACCGCCTATTACCTGACCCAACCG
GCGGTAATACCAGCTCTATACAGCGACCATACGATTGCCACCTTAGCACGAAGGCCCTCAAGGATCTGGGGATCGATGTG
CACACTCAAGATTTCAGGGGCTGGTGGCGGTGGCAGACAAAGGCATTTCGACACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62