GenePrediction:GLEAN_5951 Details

Name: GLEAN_5951
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:896944..894220 (- strand)
Length: 2725
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:896944..896183 (- strand)
Length: 762
Type: CDS
Source: GLEAN
Position: GCSC_82:896039..894393 (- strand)
Length: 1647
Type: CDS
Source: GLEAN
Position: GCSC_82:894270..894220 (- strand)
Length: 51
>GLEAN_5951 class=GenePrediction position=GCSC_82:896944..894220 (- strand)
ATGCCGGTTACGACTGAGGCGTCGCCGCCAGCACAGAAGCTGACCCGGTATCGTACCATCCGGGGCAGAAACGTTCCAGA
GTCGCGACGTTATGTTGAGCCGGAACAGAAACGCGCCGCTGGCGATGAAGTCGATTTTTGCACGAGACCTCCACCGACTG
TGTCAACACTGTTACCCGCAGCACTGAAGACAATGAATGACAGGACCCTCCCACCTCCGGAGGCTCTAGCTCGGCACCCT
GTTCAGCAAATGTCTCCTACTTTATCAACAGCTATTGATCGGCCAGCCGAGTCTGCGTTGCCAACGTTGCTGGCTACAAC
ACTGCCTCCAAAACCTGCTGGTTTTGCGACTGGCCGGACCCATAGCGTCAAGGTTGCCAATGGTTCGAGTACCATCGACG
CTGACGAAGCCGCTCAGCGAGACGCAAACACTGAGATGCTCTTGGCGGAGCAGAAAAGAAAAGATCTCGAGCGCCTGCAA
CTCCAGCTCGAAAACCACCAGCCCGTTGCTTCACCCCCCCGGAGCACCGCCCGCGATAAGCTTGCATTTTTGTCGCGCCG
GCTTGGGCAGCGAACCATTGCAAGAGACGACCTGTCGACCCCGGCGGTTTCGAAGACATCGACCGGTCCTTTCAAACTAT
CAAAGCTAGCCGGTGTCTCCTTCGATACCCCTGTGGCAACGCCCCGGACACAACCTTCAGAAGAGCAAAGCGTTGGCCAC
CTGAAAGACGCATCCTCTGCACCCGATAGTGGGACAGCTCGTGTAGGTTCTGGCTATTGGTCACTAGTTTCGCATCTTGT
CTTCGTTCTCATTATAATATTTCTCAGGAGGTTTTAGTTCGTTTTCGCCAAGTTTCGCGCAAGGTCGCTGTCCGTCCTGA
AACAACAGTTGCCGATATACTCCAGTCCAGCTCCGGCTTCCTTCAACTCGACAGCAGCAATGATAGCAGCTCACTCGTTG
AGAGCTACTCCCGTTTTGGGCTAGAGCGCCGGCTCAGGCGTTATGAGCGCATCCGCGACATAATGAACACATGGGATCGC
GATACGGACAATAGTCTAGCTATCGTTGGAGCCAGCAACAGCATAACCGCTGATCTGGATGGACGTGGGTCCGCCGACGC
TCGCAAGGATGATTCTAGCGACTCCGACATGGCCGTGGATGCTGACCTTGAATTATCTTCGGTTCGGCAAGATAAGAACA
TGCCGCCACCAGGTATTGCATTTATTCAAATGTACCACTCACAGAAGCTGGGCCGCTGGAACAAGCGATACATCTCTCTG
ATGGATGACGCGGGGCAGGTGATTGCTTCCAAGAAGTCGGATGCAATCCGCCTGGCCAGCTTGGCGACCAGCGAATATGG
TAGCAGCAATGATTTTCAAAGTCTCTGCCACCTGTCCGACTATGATATCTATCGTCCTACTGAGGCGGAGATGCGCAGGC
ACATTAAGCCCCCGAAAAGGTTCTGCTTTGCTGTGAAGAGTCAACAACGCACGGCCGTCTTTGTCAATATGGATAATCTT
GTCCATTTCTTTTGCATAGACGACCCGATGCTAGCTCGGGAGTTTTACAATCGCGTCTTCGCCTGGCGCAGCTGGTACCT
CGTCAACCGAAAGCTATCCTTGGCCCCACAAGATACAACCACGAACACTCGACAACAGCATCAGCTCACAATCCGAGCCG
GCGAGTCACCTTCTTACAGTAATGTCAAGCTTGATCTTACTTCACGTCAGCCTCCCGACGTGGGTTTGCGGGTGAAGGAA
AGCGATTACACTGCCGATACTCGGAGGACGGGGAACGCAAATGAATTCGCTGCTGGAAGTCTTTTGGGTTCCGCCTATGA
CAGCCGGAAGAATGCAGAGCCAGCTAAACAGAGCGAAGTTAAGGTCCAGGCACCAGACGGCGTACAGACTCGTATGCTAC
CTTTCACAGAAGGTTCACTTCTGGGCACTGACCGCTCGCTCCCTGCTGCTCCCACGGCTGCCAATTCTGCTTTAACTCCG
ACCTCTGCCACTGCGGCAGCCAGTCGACACGAGCCGTCTTCGTGCTTCCCATCGGCAACAGAACATACTGCGCGGAACCA
TGACCAGCCAAGCCGCAGGCCGGCTGCATCTTCGCGGCCGTCTTCTTCGTCCAGTACCTCGCAGCAGCAGGCTCTTTATC
TCTCCGCAGGGAAGCTTTCAGGACCAACTCACGTCAAATCTCCTCCAGCCTCTATGCACCGAGGTCGCCAACCGTTTGTC
GACTCTGAGGTTTCTATGGACCGCCAGCAATCCCTACGCCGCGCCACCTCCCACACATCCTCCTTCCGGTATGAGCAACA
GCAACACCCACGGATGCCAGCACCCCTTATCGACCTGACACCCAAGTTCCAAGAAGCGCCACAATGGTCCTTGGAACATC
GCGGACGTGGCGTGCGTGCTCCTCCAGGTATCACACACCTGGTCGATCTAGCCACCAGATCAACCGGAGGGGGCGACCCT
ACATTTGAGCCCGCAGCTGCCCCTCTCCGACGCGATGGCACTGATAGCACACCGCCTACGCGCTCTAGGACTGTGCGTGC
ACAAACCATGACTTCAGCTTCGGCGGCAGGGGCGGCCCGGTTTGCTCGTAGCCATCATACGGTCCATCACTCCTCTCGTT
CTAGAGATCCCCCCCCTATGCCACTACTCTCCAGGATCTCTGCGGCTTCCTCTTCTGCACTCGATTCTACGATCACCTCC
CATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62