GenePrediction:GLEAN_5952 Details

Name: GLEAN_5952
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:891329..889977 (- strand)
Length: 1353
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:891329..891276 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_82:891206..890857 (- strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_82:890688..889977 (- strand)
Length: 712
>GLEAN_5952 class=GenePrediction position=GCSC_82:891329..889977 (- strand)
ATGAATTGGGGTTGCTGGCAAGAGATGACCATGCTCATCTCCAGGGTCGACGAGGTATATCCACATCCACACGCATCCAT
GCTTTCTAAGAGTGACAGACTAACGCCGAGTTCCAAACAACAGCTGAACAAAATTGCACCGAAGCTTCCGCAGAATATTG
TATCTTTCATGTTCCACTTGCACGCCTCTCTAGAGTTGTACCAACAGGGCCATAACTTGGCCACATCATTGGATCAGCTC
CTCTCCATCTTCCCCAACTCTTCATTTTTGCTTACGTGCAATGCTTTGTTAGCGTACCACAGCAAAGACTTGATGGCCGC
AGAGCAGCGCTTCAGCACCTTGCTTTCGCAACACCCACACCGTCTGGACTCCTTAGACCATTATTCCAACATCTTGTACG
TTCTCAATCTGCGCCCTAAACTTGCCTTCCTCGCCCATCTCTGCTCCAGCCTGGACAAATTCCGACCAGAGACGTGTGTG
GTGATTGGGAACTATTATTCCCTCATGTCTTCTCATGAAAAAGCGGTGCAATATTTCCGAAGAGCTTTAGCGCTTGACCG
ATCCTGCCTCTCGGCGTGGACGCTTATGGGCCATGAGTTTGTCGAATTAAAAAATACACATGCGGCCATAGAATCATACA
GGCGTGCTGTGGACGTCAACCGTCGGGACTACCGTGCCTGGTACGGCCTCGGCCAAACATACGAGGTTCTTGAGCTCCAC
ACATACGCCTTATGGTATTATAAGAAAGCTGCGGGACTTCGGCCTTGGGACGGCAAAATGTGGATGGCCGTCGGGTCTTG
TCTACAGAAGATGGGGCGCGAGCGCGATGGTATAAAGGCCCTCAAGCGAGCCCTCTTGGCGGATGCGAATTACGACTCCA
CTGGGGCTAATTTTGGTGGCAATGTTGACAATAACGGTCCCCGGGGAGTGGCAGGCCACCTTGACCCAGAGGTTCTATTG
CAAATTGCCAGTATGTACGACCAACTGGGCGATAAAGACGAAGCTAAGGCGTACATGGAGCTGTGTATGGCTCAAGAGGA
TGGCGAACAAGATGTCAGCCTGGGCGAGTCCGTGGTGCTACATCGGGAGTCTATGGGAGGTGGAAAAGACGATGTCGATC
GAGACAGAGATGGTGGCACGAGTGGTGAAGGGACCGGGGTGACCCCAGCTACCAGCAAGGCGCGTCTATGGCTGGCACGG
TATGCGCTGAACGATGGCGAGCACCTCACAGCGTGCCGTCTAGCTCAGGAGTTGTGCCAGGATGGGGTAGAGGTAGAAGA
GGCCAAGGCGTTGATGAGAGAAGCTCGGGCAGCACTGGAACAACAAAATGACCATGGAAGGAGTAGCAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62