GenePrediction:GLEAN_5953 Details

Name: GLEAN_5953
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:877530..876476 (- strand)
Length: 1055
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:877530..877184 (- strand)
Length: 347
Type: CDS
Source: GLEAN
Position: GCSC_82:877124..876476 (- strand)
Length: 649
>GLEAN_5953 class=GenePrediction position=GCSC_82:877530..876476 (- strand)
ATGGCGAGCAGGACGGACAAAATCGAAAAAATCATTTCGCGCATGCAAAAGCGCATCAGCGAGGGCCAATTTTACGAGGC
GCAGCAGCAGACACGGGTGGTGGCTGTCCGCCATATTAAAACGGCGAACTGGGCTGCGGCAATCGACATCCTATACAGTG
TTGCGCAGTCGCTTCTCAAAGCTGGTCAGGGCGGAAGTGGAGGCGACCTTTCCATCTTTTTGGTAGATGTCTACAAGCAG
GCGGAGCTCAAACCTGACGCCGCGAACAAGGGCCGACTGCTCACATGCCTTCGGCTGTTCGACCAAGAAGAGCCGACACG
GAGGAAGTACATCGCTGAGATTATAGGGTATGCCGAGTAAATGGAAACCAGTGATGCCCAGTCTATGGCTAACTATATCG
GTGAAGATGGTCTGCGAGATTCGGGGCATATCCAGCTGGAGACCCTGAGCTACACCATGTTATCGGCTCTCTCTACGCAG
AAGAGCACGAAGCGTACGAAGCAGAGCGTCATTTAGTCACGGGGACTAAAGAATCGCCTGAGGTTCTGGCACACATGGAA
TATGATTGGTACAAACAAGACGATGCGCACACGGCCCCGTTGTATGCAGGTCGGGCTATTCTGCCGTATCTCTTGATGGC
CAACGTGCGCGCTGCCAACCACTGTTACCGGACTTTTACTAGTGCTCTGACTGTCGACAATCCTGCTCTCGCTGTCCAAG
ACGTCAGCAGCGCCAGTAACGACGCCCGCGTCTTTCCTAGTCTACCCCTGCTCAATTTTCTTGGCCTTCTCCTTCTTGCT
ATCCAGAGAGGCAGCCCAGAGCTCTTCCGGCAGCTAGCTAGTAGGTACTCTAACCAACTACGAGAAGTCGAATCATGGAG
CGAACCGCTTGAACTGGTAGCCGAAATGTATTTCGGAATCCAACAGCCGCGCCAGAGAAACCCGCTGTTTGACATGGTGG
GAAATCTGTTTGGTGGTGGTGGCAGTGGCGGAAACCGGCCGTCGAATAGAACACTGCCCAGTCTCGATGCGCCTGCTGCA
GAAGGACTCGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62