GenePrediction:GLEAN_5954 Details

Name: GLEAN_5954
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:875342..871885 (- strand)
Length: 3458
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:875342..874581 (- strand)
Length: 762
Type: CDS
Source: GLEAN
Position: GCSC_82:874497..872684 (- strand)
Length: 1814
Type: CDS
Source: GLEAN
Position: GCSC_82:872626..871885 (- strand)
Length: 742
>GLEAN_5954 class=GenePrediction position=GCSC_82:875342..871885 (- strand)
ATGCCCGCCACTGTACTACCCCTAAAGCGTGTCTTCGGCGAAGCTTCCAGCACTCGTCGGGATATTCCATTGTCCCCATC
CGCCTCAGTCAAGAAGCGCCGGCTTGAGCTGCCATCGTCAACTCCTTCCAAAAGGTTCCCGAACTCACAGATTGGTGGCC
GCTTGAACTCAAGCCAAATAAAAAGCACCTTTGAGTCCGAGGTCCTCGAGAAGCTCAGCCAGGACATATCGGACCTAAAA
CAAAATAACAGTGAAAGAGACCAGTCTTGGGACCGGCCGTCCCTCCCTGATACCTTCAGCCATAATGTGGATAGCCTGGT
ATTTCAACAGATTGAGGCCGAAGAGGGCACTATGCATGGTGGCCGCACCACGGTCAAACTTTTCGGCGTGACCGAACGCG
GAAACTCAGTTGTGCTGCATGTCACAGATTTTCGACACTATCTCTACGTGGCTGCGCCTTCGTCTTTTGTGCCGTCCGAC
TGTCAGGCCTTTCGTGCTTATCTAGAAACACAGTTGGCCATGCATCAGAACGCCATTCACTCTGTTCAAATGACGATGCG
GGAAAGCATTCTGGGATTCCAGAACAATACACAAAACCCATTTCTGAAGATCACAGTCACAGATCCGAAGCATATTAGCA
GGGTACGGTCTCTGATTGAGGGAAGAAAGGCCAACTGGAAGGGATTATGGGGGCAGAGCGAAAATCAGATCATGACTTAC
GACAACCTCCAATACGTCATGCGCTTTATGGTCGACTCCGACGTAAGTGACCCCGGCTTCGTCACCCCTAAATCGCTCAT
TTCACGGCGTACGTATGCATGTGACTAACGCGTTGTATATTGCAGATTTTTGGAATGTCCTGGGTGGAAGCTCCCGCGGG
AAAGTACCAACTAGTGCCTGAACAGCACCGACAATCAAACTGCCAAATTGAGGCGGAAGTCAGCTGTATCGATCTCATTG
CCCACAAACCCGTCGGTACCTGGTCAAAAATGGCGCCTCTCCGGATACTATCGTTTGACATCGAGTGTGCTGGCCGCAAG
GGCATCTTTCCAGAAGCAGAACACGATCCTGTCATACAGATTGCCAATGTCGTGACACGGTACGGAGAGAAGAAGCCATT
TGTCCGAAATGTGTTTTGTTTGGACAAGACTAGCTCTATCGTGGCGACAGAGATTCTAGAGTTCGAACGAGAAGAGAAAA
TGCTCACAGATTGGCGTAATTTCCTACTTCGCATTGATCCGGACATCATCACTGGCTACAACATCAGCAATTTTGACTTT
CCCTATCTTCTTGATCGAGCCAAGCATCTCAAAGTGGGTGGATTTGAGTACTGGACTCGCATACCCAGCATGAGGTCGCA
GTCTAAGGATACAAATCTTTCCAGCAAACAAATGGGCAGTCGTGATACAAAAGCAACGAACATCAACGGCCGACTTCAGC
TTGATCTTCTGCAGCTAATTCAACGTGATCACCATCTTCGCAGCTATACGTTGAACTCTGTCTGCTCTCATTTCCTCGGC
GAGCAAAAGGAGGATGTGCATCACACCATGATTACAGAGCTGTTTAACGGCACTCCGGAAAACAGACGTCGACTTGCCTT
GTACTGTCTAAAAGATGCATACTTGCCACAGCGATTGATGGATAAGCTATCGTGCCTCGAAAATTACACCGAAATGGCTC
GAGTGACCGGTGTGCCATTCAACTTCTTGCTATCCCGAGGTCAACAGGTGAAATTTATTAGTCAGCTTTTCCGCAAGGCT
ATGGATCAAAAGCTTGTTGTCCCCAACGTACAGCCGAAGGGCTCCGAAGAGCAGTACGAGGGTGCCACAGTCATTGAGCC
AGTTCGTGGCTTCTACAAAGTTCCCGTGGCAACTCTAGATTTTGCATCTTTGTACCCAAGCATCATGCAAGCTCACAACC
TTTGCTATACAACGCTGGTGAACAACGCAGCAATTGAGGCATTTGGTCTGAAAAAGGATGTGGACTACATTGTGACGCCA
AACAAAGACAAGTTTGTAACCACCAAGCAACGCAAGGGACTTTTGGCACAAATTCTTGAAGAGCTTTTGGCGGCAAGAAA
GCAAGCAAGGAGAGAACTTGCAATGGAGACAGACCCTTTCAAAAAGGCTGTCTTGAACGGCCGACAACTGGCGTTGAAGA
TCAGTGCCAACAGTGTTTATGGACTGACAGGCGCCACCAATGGTAAATTGCCCTGCCTCGAAATTGCTCGAAGCACAACC
AGCTATGGACGACAAATGATTGAACAGACGAGAAATGAGGTGGAGCAACGGTATAGCGTGGCGAACGGCTATTCGCATAA
CGCACAGGTCATCTATGGTGACACTGATTCGGTCATGGTCAAGTTTGGCACAAAGGACCTCACAGAGGCAATGAAACTCG
GTGAGGACGCCGCACAGTTTGTGTCGTCTAAGTTTGCCAAGCCCATCAAGCTTGAGTTTGAAAAGGTTTATTACCCATAC
CTGTTGATCAACAAGAAGAGGTATGCTGGGCTGTATTGGACAAAGCCAGAAGCTTATGACAAGATGGATACAAAGGGGAT
TGAGACGGTGCGGCGTGACAACTGCTTGCTAGTGCAGACCGTGATCGACAAGGTCCTGCGAATGATACTCGTTGATCAAG
ATGAGGTTGGAGCGCAAGCGTGAGTGCAGCAAAGTTGTCAAGTCCCAATCAATCCACCGTTGCTAACAGGATAAAGATAT
GTCAAGGACACTATTGCCGACCTTCTTCAGAACAAGGTCGACATGTCAAAACTCGTGATAACTAAGGCGCTCACCAAAGA
GAGCTATACAGCGAAACAAGCGCATGTTGAGCTCGCAGAACGAATGAAAAAACGGGATGCTGGATCGGCTCCTGGCCTAG
GCGATCGGGTGGCATACGTTATGGTGAAAGGTGCCGCGGGGTCCAAAAATTTTGAGCGATCTGAGGACCCGATCTACGTG
CTGGAACATAACGTCCCTATTGACACAAAATACTATCTGGACAATCAACTAGCCAAACCTCTGGGACGAATTTTCGAGCC
GATTCTGGGCGAGACCAAGGCGCGATCGCTTCTGACGGGAGATCATACTCGTGCTATTTCTGTGGCGGCGCCCACGATTG
GTGGATTGATGAAATTCGCGAAGAAGACGCAGACCTGCATGGCATGCAAAAAGCCACTTACTGGCAAGGAAGAAAGCCTG
GGGGCAGTGTGTTCGGATGATGCGCCGCGAGTGGGCGAGTTGTACCAGAAGACGCTGGACAAGGTATCAGACCTGGAAAT
CCGTTTTGGACGCCTATGGACGCAGTGTCAGCGGTGTCAAGGCAGTATGCATTGTGAAGTTATTTGTAGCAGCAAGGACT
GCCCAATCTTCTACATGCGAATGAAGGCGAAGAAGGATCTGGAGGACGCCAACAAGGACCTAAGGCGGTTCGATTTCGAC
GTGGCCGCGATGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62