GenePrediction:GLEAN_5956 Details

Name: GLEAN_5956
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:869339..867590 (- strand)
Length: 1750
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:869339..869334 (- strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_82:869132..868833 (- strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_82:868768..867590 (- strand)
Length: 1179
>GLEAN_5956 class=GenePrediction position=GCSC_82:869339..867590 (- strand)
ATGTTTGTAAGTAATCCAGTCTGGTACATTTGCTTTGAGCCTGTCAAATCTTTTCCTGTCTGCTTTGGAACGTGAGGAGG
GACATTCATGACCTTCCGTTCCACTGATTGCTCTCCGTGTTTTTGTCTGAGAGCGCCACCAGATCATACCACGGTGATCT
CCCTATTACATAACATAACTTCAAAGCAAGCATCTGACATTGCAAAGGTTGCGACTACACTCCTTGCGCTTGGCGCAACC
CTCGTCAGCGCGGTTCCGTCTCTTGTGGTTAAAGGGAGTCAGTTTGTCAATCCGTCCACTGGAGACCGATTCCAAGTTGT
TGGTGTCGCATACCAACCGGGCGGCTCTTCAGGTTACAACCCATCACTCGGCTTCGACCCCCTGAGTGATGGCTCAAAGT
GCCTTCGGGATGCCGCTCTCATGCAGATCCTAGGAATCAACGCTATCCGCGTATACAATCTGGATCCAGACTTGAACCAT
GACGAATGCGCCAGCATCTTTAATGATGTAAGTTTGCCGGACGTTACGGGCATGTGCATTCTTTTGATTGCTAATGATTT
CAATGACATAGGCGGGTATGTATTTGATGATCGATGTCAACTCTCCTCTCGTTGGTGAGAGTCTCAACAGTGATGAGCCC
TGGACTAGCTATTACGCTGCCTATCTCAATCGGACGTTTGCTGTTGTTGAAGCGTTTCGCCATTATCCAAACACGCTTTT
GTTTTTCTCTGGTAACGAGGTGATCAGCGATCTCGACAGCGCCAAAGCCGCCCCCCCTTACATTCGAGCTGTGACCCGTG
ACATCAAGACATACATTGCTAAGCATTCCGACCGCTCCATTCCTGTTGGCTATTCTGCTGCCGATGTGCGTTCAGTGTTA
TTTGACAGCTGGAACTACTTCCAATGTGCGGAGTCAGGTGTTGCCAACGATACTAGCCGTGCCGATGTCTTCGCCCTCAA
CAGTTATAGTTGGTGCGGCGACAGTAGCTTCACCACAAGCGGCTATGATACTTTAGTCGAAGGCTTCAGTGGCACTTCCA
TTCCCGTCTTTTACTCCGAATTTGGCTGCAACGTCCCCGCACCGCGAATTTTTACCGAAGTTAGCACCATATATAGTGAC
AAGATGATGCCTGTTTTCAGTGGTGGAGTTGTATACGAATACGCCAATGAGGTCTCCAATTTCGGTCTAGTCAACATTAG
CACTGATGGTAGTGTTGACATCCTCCAAGATTTCTATACTTTGCGGGACCGGTACAGCAAGATCGACTTCAAGTCCATTC
AGACAACTGTGGCCAACACTTCGACAACCAAGCCTCCTGTCTGCAGCTCCAAACTTATTTCCAGTGATGGGTTTGACAGC
AACTTCACCTTGCCTGTTCTTCCTCCTGGCGCACAACAAATCATCGACAACGGCGTCTCGCCGAAGCCCAGCGGCAAAAT
CATCGCCATCTCTAATTGGAACGTCAAGTTTACAGTTCGCAACCCTGATGGAACTGTTCTGAGTAATCTTTCTGTCAAGC
CTATCTCGGGTGGCAAGGCAAATACTCCAGGAAGCAATACGGCGTCCAGTACATCTATACCGACGTCCTCAAAAACCCCG
ACAGCGTCAATGTCAAGTGGGGCCTCTGCTTCTGCAACTGCTAATGGTAGCATCGAAGAGAATTCTGGCACCGACCGCAG
TGTTCCCATGCCAGTTACCGTCATTGCATTCACGGTTTTCCTACCCAGTATTTGGGCTTGGTTTACGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62