GenePrediction:GLEAN_5958 Details

Name: GLEAN_5958
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:855145..854329 (- strand)
Length: 817
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:855145..854567 (- strand)
Length: 579
Type: CDS
Source: GLEAN
Position: GCSC_82:854514..854329 (- strand)
Length: 186
>GLEAN_5958 class=GenePrediction position=GCSC_82:855145..854329 (- strand)
ATGGCGAGCAAGTGGGTGCCTCTTGAACAGGAGGCTCTCGCAGCTGTTCAAACAATCCTGGCCGATTGCGCACGACCAGT
GCTATCTCACCTTGGTGTTATCAAGGGCCCGAATAGTGAGCGGCGCCAGGAACTGTCCCGTCTCGCTATTTCTGCCACAA
CGCGACGACTACGGTCCAAACTCGTCAAAGGTATCCCATTCCCACCGCCGGCTGGTCATGTTGGCCGTACATCAAAGGCA
GCCAGACGCAGCGGCTGCACACAAGAGTCCGATTTTGACTTTGAACGCACGTTGGAGTGTGTGAAGTCACTCGAACAACA
GCTAGACCCACTTCAGCACTCCATTACACTGCTTGAGGAGCAACGCAAACGTGAGGAGCGCACGCTGGAAGCGGACTATG
CGGCACTGCGGCAGCTTGAGATCAATGCACAAGCGGAGACACGCACGTGGCGTGATCGGACTCGCCGGTTGCACGTCCTA
GCGCCCACCGGTGATAAAGCATCGCAGTCCTTAAAGTTTCAGGCCAATGTAGAGCTATTAGAAAGGCCAGACAAGAATTG
CGATGGCGGCATCTACGAGGTCGGTATACCTTCCCTTCCTCCAGATCTGTTTCTGACCGGCTATTCCCCAGGACATCGAC
AAGGGGTTGTCAGCACTATCCGCACAGCTAGGGAGCCACATGGAAAGCTTGAGGAACAACCTGCTGCAAGTCCAAGACGT
GGTGCCAGCTATTGCGCAAAGCAAGGCGGTCCTGCAACAAGCTCTGCGCAGGCATCTGGATGACCGGCAATTCGCGCACG
TCGTTCTAGGCAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62