GenePrediction:GLEAN_5959 Details

Name: GLEAN_5959
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:853619..851164 (- strand)
Length: 2456
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:853619..853547 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_82:853467..853310 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_82:853236..851164 (- strand)
Length: 2073
>GLEAN_5959 class=GenePrediction position=GCSC_82:853619..851164 (- strand)
ATGGTTCAATCCGCGATTCTGGGTTTCCCTCGTATGGGAGTCAACCGTGACTTGAAGAAGGCTACCGAAGCTTGTGCGTC
TTTATATTCCCCTGACTCACACGCCAATACTCTTCCCTCGTCTATTGCTTTCCATTGAAACTGACCGGATAGACTGGGGA
GGCAAGATCACTCAGGTCGACCTGCTCGCTGAGGCCAAGCGCCTCCGTCTTGCGCACTGGAAGATCCAGAAAGATGCCGG
TGTCGACATCATTCCCAGCAATGACTTTGCCTTGTACGACCAGGTGCTCAGCCACATCCAGGACTTCGGTGTATGCCTTC
CATACCCCTCTTTGTCTCTCATCGGCGTGTTGCACCGTTAATTCTAATGCAATCTCTTTTCAGGCTGTTCCAGAGCGGTA
CACCAGCGCTAAGCTAAACCCCATTGATGAGTACTTTGCGTTGGGTCGTGGCCATCAGAAGGGTGGTGTCGATCTTCCAT
CCCTGGAGATGGTAAAGTGGTTCGACTCAAACTACCATTACGTCAAGCCCACCCTGCAGGACAACCAGGACTTCACCCTA
GTGGCTAAGCCAAAGGCCGTGGTCGAGTTCCTCGAGGCGAAGGAGGCTGGAATTGTCACCCGCCCTGTCCTCGTTGGTCC
GGTCACCTTCCTGCACCTCGCTAAGGCTGACCGAGGCCAGTCGGTTGACCCCATCGACCTGCTGTCCAAGCTGCTGCCGG
TCTACGATGCTCTCCTGGCGCAGCTTAAAGAGGCTGGCGCCAAGACTGTTCAGATCGACGAGCCCGTCCTCGTTTTCGAC
CTGCCAGCAAAGACAAAGGCTGCTTTCAAGACTGCGTATGACCACTTTGCGGCTGAGGCTGCCAGAATTCCCGAGCTCGT
CTTCTCCACCTACTTCGGCGATGTTGTGCACAACTTGGAGGCTCTGCCAAAGGACATTTACGCCGTGCATGTTGACCTGG
TACGCAACCCTGAACAGCTGGACACTGTTATTGGTGCTCTTGGTCCCAAGACCGTGCTATCTGTTGGTGTTGTCGACGGC
CGCAACATCTGGAAGACGAACTTGAAGCGCGCTATTGAAAAAGTCGAAGCTGCCATCCAGAAGCTTGGCAAGGACCGCGT
CATCGTTGCCACATCCAGCTCACTCCTTCACACGCCGCACACGCTAGCAAGCGAGAAGAAGCTGGACGCTGAGATCGCCG
ACTGGTTTTCGTTTGCCAGTGAGAAGGCTGTCGAGGTGGCTCTCATTGCCAAGGCAGTGACGGACGGCCCTGACTCGGTT
CGCGCAGAACTGGAGGCCAATGCCAAGTCGTGGCAGGCACGTGCTACATCCAGCCGCACTAACAACCCGAAGGTGAAGGA
GCGCCAGTCGCAAATCAAGCCAGAGGACTACAACCGCAAGTCGGAGTTCCCGGAGCGCATTGCGCAGCAGCAGAAGAAGC
TGAACCTGCCGCTGTTCCCCACTACGACCATTGGCTCGTTTCCCCAGACCAAGGAGATTCGGCTGCAGCGCAATAAGCTC
ACCAAGGGCGAGATCACAGAGGCCGAGTACGACCGCTTCATTGAACGTGAGATTGACGAGAACGTTCGCATTCAGGATGA
GCTTGAGCTGGATGTGTATGTCCACGGCGAGCCAGAGCGTAACGACATGGTGCAATACTTTGGTGAGCGCTTGGACGGTT
ATGCCTTCACCACACACGCCTGGGTGCAGAGCTACGGCTCTCGCTGTGTGCGCCCACCCATCATTGTGGGTGACATCTCT
CGGCCAGCGCCCATGACGGTAAAGGAGAGCAAGTACGCCGCATCGGTATCCAAGAAGCCGATGAAGGGCATGTTGACGGG
CCCAGTGACGTGCCTGCGGTGGTCGTTCCCTCGTGACGACGTGCACCAGTCAGTGCAGGCAGAGCAGCTAGCTCTAGCGC
TGCGTGACGAGGTAGTGGACCTGGAGAAGGCCGGCATTGATGTCATCCAGGTGGACGAGCCGGCGCTGCGCGAGGGTCTT
CCTCTACGGGCTGGCAAGGAACGTGTGGCCTACCTGGACTGGGCGGTCAAGGCGTTCCGCCTGTCGACGACGGGCGTGGA
GGACTCGACGCAGATCCACTCGCACTTCTGCTACTCTGAGTTCCAGGATTTTTTCCACGCAATTTCTGCGCTGGATGCTG
ACGTGCTGTCGATTGAGAACAGCAAATCGGACGCAAAGCTTCTTAAGGTGTTTGTGGACTCTGCGTATCCGCGCCACATT
GGCCCCGGTGTGTACGATATCCACTCGCCGCGTGTGCCGAGTGAGCAGGAGATTTGCGACCGCATTGAGGAGATGTTGCA
GTTCCTGAAGCCGGAGCAGCTGTGGATCGATCCTGACTGCGGTCTCAAGACGCGGCAGTGGACTGAGACAAAGGCGGCAC
TGGTGAACATGGTCAACGCCGCCAAGTTCTACCGGACCAAGTACTCGAAACAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62