GenePrediction:GLEAN_595 Details

Name: GLEAN_595
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:825008..827569 (+ strand)
Length: 2562
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:825008..827569 (+ strand)
Length: 2562
>GLEAN_595 class=GenePrediction position=GCSC_97:825008..827569 (+ strand)
ATGCATCTCATTCCCAGAGAGGTGGACAAGCTTGTGATCTCGCAGCTCGGATTCGTGGCGCAGCGACGGCTGGCGCGCGG
GTTGCGGCTGAACCACGGCGAGGCAGTGGCGCTGATTGCGAGCAACCTGCAGGAGCTGATCCGCGACGGACGACACAGCG
TGGCAGACCTGATGGCGATAGGGGCGACGATGCTGGGACGGCGCCACGTGCTGCCGTCGGTGTGCTCGACGCTGCGCGAG
ATCCAGGTGGAAGGCACGTTCCCGAGCGGGACGTACCTGGTGACGGTACACGACCCGATCAAGACAGACGACGGCGACCT
GGCCCAGGCGCTGTACGGGAGCTTTTTGCCGGTGCCAGACGCGAGCCTGTTTCCGCCACAAGCAGCGGAGGAGTACGAGG
CAGCGGCACAGCCGGGCGCGGTGGTGGTGGTGCGGCAGCAGGCGGGCGAGACGACGAAAGCGCTGCCGATGCTGCGGCTG
AACGAAGGCCGAGCACGAGTCCGACTGGCGGTGACCAACGGCGGCGACCGACCGGTGCAGGTGGGCAGCCACTACCACTT
TATCGAGACGAACGCACAGCTGCAGTTTGACCGGCTGGCAGCGTACGGGTTCCGGCTGGACATTCCGGCCGGCACGTCGG
TACGATTTGAGCCAGGCGACACGCGCACGGTCACGCTGGTGGCCATTGGCGGAAAGCGGGTAATTCGCGGCGGCAACAAC
CTGGCGTCGGGGCCAGTGGACCTGTCGCGGGCCGAGGCCATCGTGGCGAAGCTGCAGGAGGCTGGATTCGCCCACGCCGG
CGGGACGGCCGAGCCGCTGGGCGACCTGGGCACGACGGTCTTGGATGGGGCACAGATGAGCCGGGCAGCATACGCGGCCA
TGTTTGGGCCGACGACGGGCGACCTCGTGCGGCTGGGCGCGACAGCGCTGTGGGTGCAGGTAGAGCAGGACCTGACGGCA
GCACACGGCCGCGGCGACGAGTGCAAGTTTGGCGGCGGCAAGACGCTGCGCGAGGGCATGGGCCAGGCATCCGGACGGGC
CGACGCCGATTGTCTGGACCTGGTGGTGACCAACGCACTGGTGCTGGACTGGACGGGCATCTTCAAGGCCGACATTGGCA
TCAAGGGCGGCGTGATCGTGGGTCTGGGCAAGGCTGGCAACCCGGACGTGATGGACGTGTCGCCGGCCTGCATGGTTGTC
GGCAGCTGCACAGACGTGGTGGCGGCCGAGGGACGGATCGTGACGGCCGGCGCGGTCGACACGCACATCCACCTGATCTG
TCCGCAGCAGGCACAAGAGGCGCTGGCGGCCGGGGTGACGACGCTTTTGGGCGGCGGTACGGGGCCGAGCGCGGGCACCT
CGGCGACGACGTGCACGCCGGGCGGACACTACATCCAGCAGATGCTGCAGGCCGTCGACGGACTGCCGGTCAACGTGGGG
ATCACGGGCAAGGGCAACGACAGCGACGAACGGGCACTGCGCGAGCAGGTAGCAGCAGGTGCATGCGGGCTGAAGCTGCA
CGAGGACTGGGGCTCGACGCCGGCAGCGATCGACGCATGTCTGCGGGTATGCGAGGAGACGGACGTGCAGTGTCTGATCC
ACACGGACACGCTCAACGAGAGCGGTTTTGTCGAGAGCACGGTGGCGGCGATCGGCGGCCGGACCATCCACACGTACCAC
ACCGAAGGAGCCGGCGGCGGCCACGCGCCCGACATTATCAGCGTGGTCGGGCTGGCCAACGTGCTGCCGTCGAGCACGAA
TCCGACGCGGCCGTACACGCGCAACACGCTGGACGAGCACCTGGACATGTTGATGGTGTGCCACCACCTGTCGCGGGCCA
TTCCCGAAGACGTGGCCTTTGCCGAGTCGCGCATCCGGGCCGAGACCATCGCGGCCGAGGACGTGCTGCACGACCTGGGT
GCCATCAGCATGCTGAGCAGCGACTCGCAGGCCATGGGTCGCTGTGGTGAGGTTGTGCTGCGCACCTGGAACACGGCTCA
CAAAAATCGCCTGCAGCGCGGCCGCCTGCCCGAGGATGCCGCCACCGATGCCGACAACTTTCGTGCCCGCCGCTACGTCG
CCAAGTACACGGTCAATCCGGCCGTCGCCCAGGGCATGGCTCATCTCGTCGGCAGCGTCGAGACCGGCCGCCTCGCCGAC
CTCGCCGTCTGGGATCCCGCCTGGTTCGGCGTCAAGCCGGCGCTCGTCCTCAAGAGCGGCCTCATCGCCTGGGCCCATAT
CGGCGACCCCAACGCTTCCATTCCCACCGTTCAGCCCGTCCTTGGTCGCCCCATGTTCGCTCCCCTCGTCCCGGCCGCCT
CCGTCGCCTTTGTCAGCCAGGCCAGCATCGACAACGGCCGCGTCGCCTCCTACGGCCTTCGCAAACGCGTCGAACCCGTC
CGCCGCTGCCGCGCCCTCACCAAGAACGACATGCGCCTCAACGACGCCCGTCCCGATGTCAAGGTCGACCCGGAGGCGTA
CACCGTCTTGGCCGATGGCCAGCCGTGCATGGCTGCTCCGAGTGAGACCTTGCCGCTGACTCAGCAGTATTTCGTGTACT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62