GenePrediction:GLEAN_5960 Details

Name: GLEAN_5960
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:848657..846597 (- strand)
Length: 2061
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:848657..848277 (- strand)
Length: 381
Type: CDS
Source: GLEAN
Position: GCSC_82:847610..846597 (- strand)
Length: 1014
>GLEAN_5960 class=GenePrediction position=GCSC_82:848657..846597 (- strand)
ATGCAGCTCATCAACGCTCTGGCCGTCGGCCTGATGGCCACCGCCGCCTCTGCTTCGTCCATCCCGCGTGGCAAGCACCA
CAGACAGATGTTTCGTCGCAGCAACGATTCGGCCGAGGAGTTCACCACTCTGACCGTGTTGACCACCGACATCGTCACCA
TCACATCGTGCGCTGCCTCCATCACTAACTGCCCGGCTGCCACCGAGACCGACGCTCTGGCAGCTTTGTCGACCGAGGCC
ATTGTCACCGTCCTGGTGACAAACACGATCGCCCTGACCACCACCATCTGCCCTGTGACTGCTGCCGAGTCCATCAAGTC
CAGCGTGATCAGCCTGGCCAGCACCGGTTTGATAACCGGCACCACTCTTTCGACTTCTGACGTTGCCGTGATCACTGCCA
GCAGCAAGACCAGCGCCTCTGAGACTGCTGCTACTGCTGCCGTGACTGCCTCGAGCGGTGCAGCTTCTTCTGAGACTGCT
GCTACGGCTGTTGTGACTGGTGCCTCCAGCGGAACTGTTTCCTCTGCCACTGCTGGTCTGAGTGCCTCTAGTGGCACTGT
TTCGCCTGTCACTGTTGGTCTGACTGCCTCAAGCGGTGTCGCTTCCTCCGAGACTGCCGCCACTGCCGCTGTGACTGGCC
CTAGCAGCATCTCTGAGACTGCTGCCACTGCTGCCGTGACCGGTTCCAGCGGCACTGCTGCTCTGACTGCTTCGACCGGC
ATCGTTTCCTCTGCTACTGCTGCCACTGCTGCCGTGAGTGCTGCCTCGAGCGACACCACTGCCTCCAACAGCGCTTCATC
CCCCGCTGTCGTGGCTGCTGTCTCCTCGGGCAGCGTCTCTGGCACCTCTGGCACCGCTGCCGTAACTGCTCCCGGCACCA
AGGCCACTTCTGCCACCACCGCCGCGATTGCTCCTGGCACCAAGGCTACTTCTGCCACCACCGCCGTGGCTGCTGTCTCT
GGCACTCCTTCTGCTGCTACCGTGACTGCTCCCCTCACCAACAACACGGCCAGTGCTGCCGCCGTCACGGCTGCCACGTC
CGGCAAGCTGACCTTCCCCAACACCACGACTACGGCCGTTGGCAGCGATCTGACGACGCTGACCGTGCTCACCACCAGCG
TCGTCACCATCACCTCGTGCGCTGCGTCCATCACCAACTGCCCGGCCGCGTCCGAGACGGCTGCGCTGGCATCGCTGCCA
GTTGAGGCTCTCACCACCGTCCTGGTCACAAACACGATCGCGCTGACGACGACTGTCTGCCCCGTCACCGCCGCCGAGTC
CATCTCGTCTAGCGTGATTAGCCTGGCCAGCACTGGCCTCATCACTGGCAGCACTCTCTCGACTGGCCTCGTTGCCGCTG
TTACTGGGGGTGCTAGCAGCAGTGCCACTGCCACCGCCACCGCTGCTGCCGTGACCGGCCCGGCCGCCTCGACCTCGTCG
ACCACAACCATCACCGCCGTCGTCACCAAGAGCATCATCATGACCACGTCGGCCGTCAAGACCGTCACCGTGACCGCCAG
CACCGGCTCCAAGGGCGTCGTCAAGGCCTCCAGCGTCTTCACCACCTTCGTTGCGTCCACCTTCACCTCGGACCTGACCA
CGAGCGAGGTCCAGACCCTGACGCTGGCGACTGCCATTGCCAGCACTACTGCCGCATCGGAATCGGAGTGCACATGCGCA
GCCACGGTGACCGTCACTGCCAAGGCTGAGACCGTCTACGTCACCGTCACGGGCAATGCCGCCGTTGTCGCTGCGGCTGT
GGTTCCTACCACCACGGCCGAGGCTGCTGTCGTGGTTCCTACCACTACGGCCGAGGCTGCTGCCGCGTCCACCGACTGCT
CGTCTGACGTTGTCATCACGCTGACCCGGACGCCCACCACGGCGGCGGCTTCGGCTTCGGCCACGGCCACGGAAGACTGC
CCGTCCGAGGTCATCGTCACGGTTACGTCCACTGCGGCCAAGGCTTCCGCCACCGCGTCCAACTCGACCGTTGTGGCAGC
GTCCAACTCCACATCCAAGAAGGGATCCAAGAAGAACGGCCGCTCGCTGCCGCTCTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62