GenePrediction:GLEAN_5963 Details

Name: GLEAN_5963
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:829742..828103 (- strand)
Length: 1640
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:829742..829572 (- strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_82:829512..828103 (- strand)
Length: 1410
>GLEAN_5963 class=GenePrediction position=GCSC_82:829742..828103 (- strand)
ATGTCTCCTCCAGAAGAGCCAAGGACGACCGGGACTCCTGCACACGAAGTGTTTGGCACCATCGGCAATCAGGCTGAGCA
GGTTGCGCCAGCGACAGATGGCGTCGAAGGTGACAATGATCAACGTGTGGTCGAGGAGATTGAGTCTCTCTGCATGAACT
GTCACGAGAATGTAAGCTTTGGTTTGATATCACAAGAATTTGGTGGCCTATTGACTGACTGTATGACAAGGGAACAACAC
GTCTTTTATTGACGAGAATTCCTTACTTCCGCGAAGTCATCCTCATGTCCTTTTCTTGCGATCACTGCGGGTTTCAGAAC
AACGAAATCCAAGCCGCAGGATCGATCCAACCCCGCGGAACGCACTACGAACTGCGCTTGACGGAGATGGAGGATCTTTC
ACGCCAGGTCGTCAAGGCAGACTCGGCATCTGCCAAGTTTGTCGAGATTGACGTCGAGGTTCCGGCAGGTCGTGGTCAGT
TGACCAACGTTGAGGGCATCCTGACTGGTCTCGTGAGCGACCTTGAGATGGACCAGGAGGCACGCAAGAACGAGCAGCCA
GAAGTTTACGAGAAGATTGCCGACGTCCTAGTCAAGGCGAAATCCATGCTGGCTGGCGAGTCATTTCCGTTCCGCATGAG
CATTGACGACCCGGCCGGCAACAGCTGGATCGCTCCCGATTTGCATGACGGTGTTGGCAAGTGGGAGAAGCGCGAATATG
CGCGAACACCGGAACAGAACCAGAGTTTGGGGCTGGCCGACACTGAAGATGCTGCAGCCGGCACTACCACATCTTCATCT
GGTATACCGACAGCTTTTTCGGGATCTGCCGGTGTCATTCCTGTTGGCGGTCAGGGACGCCTGAATCCGGACGACGAGAT
CATCCTGGACGAGGTGTACACATTCCCGGCCAGTTGCCCCGGGTGCATGCACCCGTGCGTGACGCACATGAAGATGGTGG
ATATTCCTCACTTTAAGCAAGTCGTGCTGATGAACACGCTATGCGACCACTGTGGGTACCGCTCAAACGACGTCAAGACA
GGAGGTGAGGTCCCTGCAAAGGGTAGCCGCATCTCTCTGAAGGTGCTCAACGAGGTCGACCTAGCGAGAGACATCCTGAA
GAGCGAGAGCTGCGCACTCGAATGCCCAGAGCTCAACCTCTCTGTCAATCCAGGCACGCTGGGTGGACGCTTCACGACTG
TTGAGGGCCTGCTCACACAGGTGAGGGACGACCTTCGCAATCAGATATATCAGACGGGGGCTGAGGTGGGCGCGTCGCCA
GCTGGTGCTCCGGCAGCCGGTGGCGACTCCCTCAGCGGCGATGATCGTATGCAGTGGACGTCTTTCTTTGCTGGTCTGGA
CGAGGCCATTACCGGCAAGCGACCGTTTACGATCGTGCTCGCAGATCCGTTAGCAAGCTCGTATGTTCAGAGTCTGGCAG
ACGATCCCAGCAAGCCAGACTCGCAGATGACGATAGTCGAATACGACCGGACCGCAGAGGAGGAAGAGGACTTGGGACTC
TCAGATATGAAGACTGAGGGTTATGAGGGAGAGGCAGAAGCTGCAGAAGCTGCACATGATGCACAGATAAAGGAGGATGC
GGCAAAAGCGGATGCGGCAATAGCAGACGCGGCAAATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62