GenePrediction:GLEAN_5965 Details

Name: GLEAN_5965
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:817085..814490 (- strand)
Length: 2596
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:817085..816568 (- strand)
Length: 518
Type: CDS
Source: GLEAN
Position: GCSC_82:816494..814490 (- strand)
Length: 2005
>GLEAN_5965 class=GenePrediction position=GCSC_82:817085..814490 (- strand)
ATGTCAGCGCCGAACTCTCGCAAGCGCCCTGCGCCGGGGGCCGCACCCATTTTACCCGTTACTTCAGCGCAGCCGGCTGC
TTTCAACACTTCATCACAGGAGCAGCTTCTCAGGTGGCCAAGCGGCATGACGGATCCCTCCGCTTACAGCGACATTACGA
GAAATGCAAATACCTTCATGATGAGCGCAACGCCTGGCCAATACATGCAGCAGCCGCAACAACTTCTTCCTCAGCAGAGC
TCCCCACAGCAATCTCAGCAGCAGCCTCAGCCAATCTCGACAGCCATTGCGCGACGCCCCCCAAACCGCGCTTTGATCGC
GTCTGCACCCCGTCCAACCTTCGACCCTGCAGCTGATGCATGGGCGGCCTTTGGCGATGATCCTACTGCCAATTCCAACG
GCGGACTACCTAGCGAAAATGAAAGTATCGAGGTCCTGGAAGAGCGGGCGCAAAGGGTCAAGAAGGAGGCCCAGGCAAAA
AGAAAACCTATTCCACCGTTCGTGCAAAAACTTAGCAGGTAAGAAGAAGCAGACACAAAGAAACCGTTGATCCTGTTACA
TTGGCCATTGGCCAGGCTAACGTGAAGGCAGTTTCTTGGAAGAACAGAAAAATACCGAACTAATTCGGTGGTCGGAGAGC
GGCGATTCGTTCATTGTGCTAGACGAAGACGAGTTCGCAAAGACCCTGATTCCAGAGCTCTTCAAACACAACAACTATGC
TTCCTTCGTCCGGCAGCTCAACATGTACGGATTTCACAAACGTGTTGGACTCTCGGACAACTCCATGAAGGCTAGCGAAC
GAAAAAACAAAAGCCCCAGCGAATACTCCAATCCATATTTCAAGAGGGGCCACCCGAATCTCCTGTGGTTGATCAACAAG
CCCAAGAGCGGCAGCAAATCGAAGAAGGGCAAGAAAGACGACGGGGACATCGATAGCGACGAGGATATCGGGATTGACGA
ACCGCTAGCTCACATGCCGGGCCTGAACAACCAGCAGAGTCGCCCCTACGGTCCTGGCAGTAGCGAACTCGGACCGCTGC
AGAAGAAGGATTTCCAGACCATCAAAGACGAGCTGAGCACCCTGCAGACGCGGCAGGCCCAGATTTCGAAGGTGATGCAG
CGGCTTGTCGCTGACAACGCGCAGCTACAGTCACAGGCGCGGATATTCCAAACTATGCACGAACGGCATGAAAATTCGAT
AAACGCCATTCTCAACTTCCTCGCCAATGTGTTCCGTAAGTCATTAGAGGAGCAGGGGGGGGTGCAGAGTGTGACGGAGC
TACTCGCCAGCATCCTGCCAAACGGACAGATGCCCCAAGGTAGCGTTGTTGATGTCAGCGACGACTTCGACACACAACGA
ACACCTGTGTCTACCACGATGAATACGCCACCCAAGAGGCAACGGCTTTTGCCTCCCATCCCAAGGCAAGCATCTACATC
CTCATCACCATCTCCCGGTCGTACAGGGGCAGCTATGTCTCCGGCACACCAGGCGTCGTCGAGCACCCCGAACTCAGCCC
ACTCCGGCATCCGTGTTGGGCCCATGGGCTCGGTGACGGAACTGCTTGACACACAGAACGACCTGGGATCGTCCAACTAC
CTCCAACAAGAGCTACAGACCAACCCACAGGAGGGCATGCTAAAGATAATCCACGACACGAATGCAAACACCCCCACCTC
CACGTCTGGCATTGATCTCCCGGAGGTAGCGGCAACCACACCTGTCAACCTCAGCAGCGACCAGCGAAACCGTGTACTTA
GCATCATGTCCGGCCAAAATCATGGCCAATCCAACGGGACCAGCATGACAGGAATGTCCACCACGGCACCCCCTCTCACG
AGTCCTGGCACTGCTTCCCTCTCAGACCAATTCTCGCTTCCGACAAATTTGGCTGGGAGCAGGGCTTCAGGGATGCCCAT
CCTAGAACCCATCACGATGCCTCAAATGAATCCTAGTATGGGTAACAGCTTTGGAGGCATGTCTGTGATGCCCGACGCTT
ATGGAAATGCTTCTACCGAGGGCGTTGGCAGTGGCAACAGTGGCAACAGTACAGCGGGACCATCCTCTTCTGCTGCCACA
TCGATTTCACCAATCCTATCCCAGATACCAAGTATACCTGCTCCCCCCTCGCTGCATGACATCTCCAACACACAGGCCGA
GATAGAAGCTCTCCAGAAGCTGCAGGATGAACAGAATGCAAAGATCACAGACCTGTCTCAACTGTTGGGCCCACTAAGTC
CATCTGGCCGAGTACCGGGCATCGAAGAGAGCGAAGGCGCTGGGGGTGGGGGGCTTGGTGGGGGGCAGAGCCCTGGCTAC
TTTGATCTCGGCCAGTATTTGGACCCGACTGCGTTTGGTGAAGATTTTAATTTCGCAACGGGCGATTTGGGTGGTGGCGT
TGGCAATATGACATCAAATTCGATGGGTGTGACAGTTCCGCTGTCTACCGACGATGACTTCAATTTTGGATTTGACGACG
CTGTGGGCAAGGTTGAAAACGAGTCGCCAAGTCCTGCAGGAACGGAGGAAATTCCACGGGCAGATCTGACAACAGGTAGC
AACAACGAATCGGTGAAGCGCAGGCGAGTCAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62