GenePrediction:GLEAN_5966 Details

Name: GLEAN_5966
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:811370..810061 (- strand)
Length: 1310
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:811370..811293 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_82:811236..810412 (- strand)
Length: 825
Type: CDS
Source: GLEAN
Position: GCSC_82:810303..810061 (- strand)
Length: 243
>GLEAN_5966 class=GenePrediction position=GCSC_82:811370..810061 (- strand)
ATGGCCGCCTTCGTCAGGGTCTCGGGCCCTCCCAATAGCAGTATACTGGTGGGCTACCCGGGAATCTCTGCCACCTTAGT
ATGCTCATGCCGTAACAAGCCCTCTCTCACAGCCTTCTCGACTAACACTGCTAGCCGCGCATTGAAGGAAAGGTCGAAAT
ACGCCCGTCTCAGGGATACTCCATGCCGGTCTCCATCTCCCTCGTTCGCATCTGTCTACAACGTCGCGAAACCATCCACC
CTGCCGCTGATAATATGGCCAGGAAACACCTGAGCACACCACGTCGCGATGCCGTCGATGTTGTCGGCAAAGAAATGCTG
CTCTTCCGCTGCGCATCTGGCAAAGAGTCCGAAAGCGTTGTTGCCATGGACTTGCCCTTTGTACTTTTTATCCCCTTTGG
CCGCGGAGGCGAGGAAACCAATCGGCGCATCCCGCCCGCATCATTACAGCTGCCCAGTCGCATCGCCGAGACCTACTACG
AGCTGGTCGTGACTGTCCAGCAAGGACCAAGCGTACAGAATAAATACTCCTTCCCTATGCCGCTGCAGCGTTACGATACA
CTGTCAACCTTTGGCATGTACAACAAGCAAGAAAACCGTGTGGTGACGACCGACAACATAGTGACGCTTGCCATCTCTTT
ACCGCGATGGAGCTATGGGCCTCTGGACCCCATTACGGTCTATATCAAGCTGGCACCCAATCCGGACTGGCTCAACAAAG
CCAAACGTGTTACAATCAAGACGATCACACTTAGCATCGAGGAAGAAATCACCTTCAACCCGGAAGGCGACGAGCCCACC
AAGAAGATCAACAAAATCGCCAAACACTCACAAAATGTCCAGACTAAGATGCCTGAGGCGGGCTACGTTACGAACCTGGG
CCTTGTGTTCCCGGCGCGTGACCTACGTGGCAGCGATGGTATCATCCGTCGCGGGAAGCCAGCATTCCCTTTGCACGAGG
TGACTTCCTTCACCACCAACTCCACACTTTACAAAATCGAATTTTTTTTGTCTATAAAGGTACGCGTCTATCCTTAATTG
GCCTGAACATTTTTCTTACACCTATAGGCACAAATGAGCTCAGCCCGGGATATTACTCTGCGCCTACCGATCGTCATATG
CCCGCTTGACCATCAAGCGTGCAAGGAAGAGATGGACGCTATTGAGCAAGCCGCTAAGGACGCTTCGCGGGTTGACCCCA
ACAATCCTATGCTACCCGCAGCTGCCATTGTTCTCGCCAACGACCGCGACTCTCTCCGGCATCTAGGCCTCTGCGTGGTT
GGTGGCCAGAAGAAGCCCCTGATCGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62