GenePrediction:GLEAN_5968 Details

Name: GLEAN_5968
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:805307..801567 (- strand)
Length: 3741
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:805307..804913 (- strand)
Length: 395
Type: CDS
Source: GLEAN
Position: GCSC_82:803835..801567 (- strand)
Length: 2269
>GLEAN_5968 class=GenePrediction position=GCSC_82:805307..801567 (- strand)
ATGGAACCGGAACCTGACGCGCCGTCTGAGAAGAAGCCCGATGTGACGGCGCTTGACTCGGCGCCCGGCGCATCCGGTCA
CCCCGCGTCGGCCTCGGGCGCCACGTCCACTCGTGAAGCCAGCGCCGCTTCTTCTTTAGCATCCCGTGACGGCCCCCCCG
ATTCTATCAAGGCCTCCTCGGGCCTGTCTCCACGGCACTCATCGGCGCGCTCGCCCACGCCTGTCGCCACTGCTGCGGTG
CCTGCTGCGGCTCCTGGACCCCGCCGCTCGCCTTTATCTGCGGCCTCTGGTCGTCGTCCTCTCCCTGGTTCGGCCCCTAG
CCAATCTGCATCATCAGCCAGCCCGACAAGCGCGCAACCTGCACGAGATGCGCCCATGTCCAAGACGTCTGCAAGGTGCG
TTTCTTTTGCATTGTTCTTGCTCCTCCACCCGACACTCCGCTCTCTTCCGTTCCTTAGCTCTCTGCCTTTACCTACTCCT
TCCTCGAACGATACTCCGCATCTGTCGATGCGTTTCCCATGTCGGCTTCCTCGTGGCCTGCGTCGCAGTTTGTCAAGTCT
TACAAGCAAGTACCCCTTTTCCCCCTATGCTCAAATCACCTGGCCTCCATTGTACCTATCCAAGTTGCGAATTCAATTGT
TCCCTATTCAGGTTTCATCGTGGGCCACCATGCGCAACAAACAATAGCCATTCACCCCCTCGAAAAGCTTCCCAGGCTAA
AGGCGCTTCCAACCCAATGTGGGCTTCCATTGACAACCTCATTCAAGCTATTGTTCGAGGCCGTTTCCTTCCTCAGGTTC
CACTTTTTTCCCTCATTCCACTTTCGACTTCTATCTTTTCTGCTTAAATCGATCTTCTGTTTCGTTTTCTCTCCCTTGAA
ACCTCTTTCTTCTGCTCAGTTTAGCATACTAGTATTATTGTCATCATCTCTGTTGCTGTCGTCTTCACCTTGCTGCCCAT
TGGCGCTGCAATCACTTACCCGGACAGTCCATTTCTTCATACTTTACTTTACGCTAGTATTTTTTTTTTACCTGGCCCGT
AACACCCTTTCAGGGCGTCATCATTAATGGACCTCTGTCTCTCCTAATTGCTCACCAATCCAGGCAAGCAATGCCCCATC
CCTTCCTAGCACCCCCTCACCCTTTCCTCGTTTCTTTCTTCGCCTCTGGCCACACATCACAGCACAACGCGGCTCTGCCT
TACACTGATGGTGAAGTGGCAGCCTGAGTGGGGCAGTCCTCTTCATCGTCTCTCCTTCATTTCCCTTTCACATAATGAAG
AAGCATGCGCAACACCCAGTTTTGAGGTACAAACCGCACTTTTCCAACACATTACTGGGACCACTCGGTGAATACGATTG
TTGCGTCGTAGCCTACTAGTCACATGTTATCTTACCACTATCTTTCCCGTTTCCGTTGTTTACGCCTGATACGCCAAGCT
ATAAGCTAACCTAGGTCTCTTTGTTGGTTCAGTGCAACCATCAGTCCAAAAGAGAAGATGACCGAACCTGAAAAGGGAGG
TATGGACAAGGTAGATTCACAGAATCGAACCAACCTGCCACTTGGCGGCCCCAGCTCCATTGCTGTCAGAGTCTCATCCA
CATCATCATCCTGCATTCCCGCAAATATCCTGGAAGACGAGATTGTTGTCGGAACCAAGCCAAATGGAAAGCACTCGTCT
CCTATACATGTCGTCTCTGATCAGGAAGATATCGAGATGGAAGACAGGGATCATTCGCCAGAACCAAGCCATCCGAAGCG
CAAGCGTTCCTCAGTCTACAATGAGCTCGAGGGAGAGAGGATTGAGCAGAGCCTGATACAGGACGACATTAAGGATGTTC
CGACCATCACATCTGCTCTTGTTGTGGACAAGGCGCCTAGACCGATGCCCCAGCCTTCTATGACTACGCAAAGGAGCATC
ACGCTTGGCTATTGGCGAGATTCGGCTGTTCCTGACGAGAATGAGAAGCATGCTGTCGTCGGCTTCATTGACACTCGCGA
CCGTCTCCGGACCCGCATCCAACAGAGCAGTCGGTCGGGAAAGTTTGTTGCCGCAGACTATCCACTCCCCCCGGGACCGG
GCGGCAGCTGGGTTACGTTTGAGCGCGTTGTTTTTGACAAGCATCTCGTCGGCCTTGACCACAATCAGGTCAAAGAGTAT
GTCAAAATACGTTCAGAGAATTCCATGGCCCACAACAGTCCGGAAGAGGAACTAGAAAATGAGAAGGTTGCTGTGAAGGA
AGCCATTCGCCGAGCGGCACTGCATCCGACCCCTGACAATATGCCTGCGCCAGCCATCGCGTACGGAGTTGATCTACCCG
ACTACGTTGTAAATGCTGCCCGGCCCGAAAAGAAGCGGCGCATGATTTCAAACGGCACTTTCGGCGCCTTTTCTTCGGCC
GCCGACATTGCCGCCAACTCGCCCAGCGCCCAGCAAAGTCTGGCACCGGCTGGCGGTTCGCCGTCAGTAGCATCGGCTAT
TCAAAGGTCGGCCATCGATCTCTTGCCGGGCACCCGCCCGACGAAAATTTTGCTTGGCTATTGGCGAGGCTCGAGCGAAG
AGCGGGTGGAGGACAAGCATGCCGTCTTTGGCATACTGGGCGCGAATGATATGTTCCGCGTCAAGGTGACTCGCGAGACT
CGTGATGGTCGTCCCGTGATGGGCAACTTCCCGACAGGCGCTGGCGCTCTTTGGATCCACTATGACGAGGTCGAATTCGA
GAAGCACATCCGCCACTTGTCTCGCCCAGAGGTGAAGGAGTACGTGCGTGTGCGGCAGCGCCAGATTGATGAGGGGGAGA
AACCCGACCAGCGGATCGAGAATGAGACTAAGGCGGTCTACGATGCCCAGGCCCGCGTTATAAGTGCTGGCGGTGTCGCT
CAGAGCACGCTAGGCACGGCTGGCAGAGTTGATACCATCAGCTTCGCGTCTGCTGCCAACCTGAACCACCGGCAAGCCGA
CAATGGGAGCAGCGAGATTCCCAGCCATTACCAACAAGACGGTCGTACTCGGCGAGAGTACGAGCCGCGTCAGACTCGCC
GCTCTTATGCGGCTGACTCTCGCGACAGTCCTGCCTCCATTGCGGCTGCTGCCATTGCCGCCACACCGCCACTGTCTCGC
TCTGGCCGCCACTCGCTGCCTGACGGAGTTGGCATGACCACCGAGCTTCGGCCTGCCAATAGACCGCCTCCAGCCGGCCA
TGGCGCGGTCGAAGGCAGCAAGGCACTGCCGAATTGTCACAATGGCAGCGGTCCGAACGCCGACCGTGTTGAACGCACCA
ATAGCTTGGCGCGCCGCGAGATTGTCCGTGTTGAGTCGATCCAGATGCGCAATGAGCAGCGTGCTGCCAATCGCGAGACC
GGACTGGTCGGCAGTGGAGGCAGCACGGCGAGTGGCATGAGTTTGGCTGGTGAACCGACGACTTCTGTCCTCGCCAGCCT
GTCTCTCAACGGCAATGCGGGCAACGGATCTGGTGTCGGCAGCTCTGCCGGCAACAACGGCGGAAGCAGTCGCCAGACTT
TTAGCGAGAACATAGGACGTCTCAACAAAGTCTGGGCTTCACAAGAGGCCACACGTCTGCGCGCCGGAGGCGAAGACGCA
AAAATCTACATGGGCGTCAAATATGAACGCAAGCAGACGGGCCCTTTCCAAGGCAAGCTCGTCAGCCCTGGCACGATTTT
GTCCATTGACGGTGAGGACTATGTCGAGTATCGCGTGCTTACTAAGCCGACATTCTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62