GenePrediction:GLEAN_596 Details

Name: GLEAN_596
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:833575..836454 (+ strand)
Length: 2880
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:833575..833698 (+ strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_97:833760..834317 (+ strand)
Length: 558
Type: CDS
Source: GLEAN
Position: GCSC_97:834381..834560 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_97:834612..835156 (+ strand)
Length: 545
Type: CDS
Source: GLEAN
Position: GCSC_97:835213..836454 (+ strand)
Length: 1242
>GLEAN_596 class=GenePrediction position=GCSC_97:833575..836454 (+ strand)
ATGCCCTCTCTCAACCCACCTCCCCTTCTCATAGGGGCTTTCGTCTTCCTCTTGCTCATCGGCCATGTGCACGCCTTTGG
AGCCGGCAACATTGCCGGCATATCCAAGGTCGAAGGCCAGAATTGTCGGTGTACACCCGAGAAGCCGAGTTGAAGTCGTC
CTTGCTAACCTTTGTCTTGACTCAGGGCGCCATGGTGACATTGAAGACACCCTCTTGAAGCTGCTCATGGCCCGCGCCGT
CGGCGGCAAGAAGTTCGACAAGCTCGCCGTCTCTCGTGTCTACTTTGGCAACTGGCTGCGCGACTACAGCCAAGCCATCG
ATGTCGGCACCGTCAAGGCCGTCTCCTCGGAGGCCATCCGCCTGCTGCTCTGTGTCCTCGGCTTCCTGACGTTTGGATTC
GGCTCCAAGGAGTTTGAGGTCACTGCTGACCGCCTTGGCTGCTACCGCCCCGAGGACCACATCGACAACCCCAAGAACTA
TGCCGACAATGTCGATGCCCGCCGCTATGATCGCCGTCTTCGCGGCCCCGTCAACGAGCGTGTGGAGCTCGCTATCGATC
CCGAGACCGGAATGAAAAACTACATTGCCAATGAGCGTGCCAACATCATGACCAGCGCCTACCACGTTCGCAAGCTATTC
GGCCGCTGCATTGAGCTGGGCCGTTCTTACCGGCGCTCGAAAAACAAGGCAGATTTCTACGAGGCCCTGCGTCTTTTGGG
TACCGGACTTCACTGTCTAGAGGGTATGCATTCAAAGCCCACATCCCTGCCCCCCTTCCCAGTATCACCCCCGCTAACCT
GCCTAGATTTCCTGGCCCATAGCAACTACACTGAGCTTGCCTTGATTGAGATGGGCGAAACTGAGGTCTTCCCCCACGTT
GGCCGCGACACAACAATCCGTCTCAGAGGTGCCAGGCACCAGGTGTATCCCTGTATCACGGGAACTTTTGGTGGTGTTGA
CTTCTTGCACTCTGTCACTGGCGAGGGTATGTGTCCCTGCCTTGTTGTCGAGAGATGTAATTGCTAACTTCGCATAGTGT
CCGACAAATTGACCCAGAACGAGATTCAGGAGCTGGAGGGAACGTTGCAAAACGGCCAGAACAGTGACACGAGCGCCCTG
CGCAACCTTCTTGACATGTTTCCGAGTGGTCTCTTTGGCGGCGGCAGCAAGACGCAGAAGCTGGACAACATCCAAAACAA
CGCCAACGCGGCACAAATGGAACAGATGACTGTGTCCCCACTTGAGCCTGAGGAATTTACGAGGCACATCCAGTTTGTCT
TCAAGCAGATCATGCCAGCCATTGAATTCCATGACGAAATCATCAAATCGATCACCGAGGCCGTCGAACAGATCCCTGTA
CTGCCCAAACTTATCGAACAGCTAGAGGAACAGCTTTCCGTCTTTGTCTTCTCGATCATTGCTCCCTTTGTCATTCCTAT
CATCCACCAGGTTCAGAATGAACTGAGTACTGGCTCGTCCGAGATTATCCAGAGCAGCCAGGCCGAACAGCTCATCGTGT
TTAACGACGATTACTGTACCGACCCAACCCATTCCATGCTGTCCAAGGACCACTTTAGCAACGTATGTTCGCTCCTTACG
CTGCTCGTCTTTGTTGCATTCTCTTCTAACCCGATCAGATTCTCAACGAAATCGCTGGCCGCACCGCCAGTAAGGTGGTG
GCTTGGGTAGTGCCACAGCTCATGGATGCTTGGGATAACGACTCCATCGACGTGAACCGTACACTAAACCGCATCGTCAA
CGGCGTCTTGCATCACCCTGCCCAACGGGCCATGGGCGAGGACGGTGCCCAAGATGGCCGTGCTCTCATGTTCCAATCCG
TTGAGGAGTGGTGGCAAAGTATGCCTGATGATGAAAGACAGGACTACCGCAACAAGCTATCTCGCAGAGGAGTAGAGCGT
GGCGAAAACCACAAAGAGGGTGTTCATGACACGGGACATGGCTGTGGACATCCGCTTAGCATGCAGAAGACCTATGGCGG
AAACTCGGACGATTCACCGGAGGACCGCATCGCCTCCGCGGCGGCCAGTGCCATTGTCGGCGGCCTCACCAGTGGAGTCT
CGAGCTTTGTTCAGCAGCAGACTGGCCTTCAGCTTTCAGAACAGTCAGGCGGCAACCAGTCGAGCTTGGCCGGTCTGGCT
GGAGCATCCGGACTCGGGGGCCTTCTAGGAGCGGCCAGCTCTTTCCTAGGATCTGGCTTTCAGCAAGCTTCCGCCCCGTC
GGTTAGCAGTCGCCGGGATGATGATGGGAGCTACAGCCAGACATATACGCAATACGGCCGCACCGAGGACGGAAAACGAT
ACGCTCAAGCTGAGTATACGCGTACTGATTATCCCGACGGCGAGGAGCGCACCGACTACCGCCGCTATGAGCAAGACGAG
GAGGGCCGCGGAGGGCGGGTTGTCGGATACGGCTTCGAAGAGCGGGCTGAGACTCACACAACTCACAGCAACACCTATGA
AGAGCGTGAAGAGCGCGGATGGGCAGACGGTAGGGGGGGGTACCGTGAGGAGAGAGAAGAAAGGTTTGGCGAGGATCGAA
GACGAGATGTCTCGAGCGGAGACGAAGGCTGGCGCCAAAGGCATGAGCACGGTGAAGAAGACGAAGGGCGGGGCGGCAGA
CGGAGCAGCGGCAGACGGAGCCGGGAGGATCGTGGATGGGAAGACCAGAGAGAGGAAGAAGAGCCGTCTAGACGTGGCGG
ACGGTCGAATGTGTATGGCGAAGAGTATTCTATACCGCCGCAGCGCTCCGATGAGGAAGCACGCGCCGGCTTCTTTGATG
GGATCGTGCGGGAAGCGCGAACCATCTTCGACGATGATGAGGTAAAACATGAGAGACACCATGAAGGATGGGGTTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62