GenePrediction:GLEAN_5977 Details

Name: GLEAN_5977
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:764420..761517 (- strand)
Length: 2904
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:764420..763147 (- strand)
Length: 1274
Type: CDS
Source: GLEAN
Position: GCSC_82:762961..762931 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_82:762876..762423 (- strand)
Length: 454
Type: CDS
Source: GLEAN
Position: GCSC_82:762362..761937 (- strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_82:761869..761768 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_82:761701..761517 (- strand)
Length: 185
>GLEAN_5977 class=GenePrediction position=GCSC_82:764420..761517 (- strand)
ATGTTTCCGCCGGCAAGGCTGCAGCAGCTGCTGCTGTTGTTTCCAATGCTCGCATCATCTCAGTCTAACAACCAAACTCT
TGATGGCACTATTTATGTAGATGGTGGTCGGACTTACGACTTCAGGCCGTACCTCGAAGGTGTGGATGCATCTACCAGAC
TGAATAAAAGTGGCGTGCATCCGGGAGGACAAAATTTCACAAAATGCTGTTACAAGGCCGTTGCCGCTTACATCAAAAAT
TACCCCGAGAACAGCACGACCATGATATTTGATCCGAGTCGTACTCAAGGCAAAATGAGCCTGATAGCTCCCTCTCGGCT
TTATGACTATTCCACTCACGGTCAGTTTCCATGTGGAGCCACCTACAACGGTAGCAACGAGGGTGCTCCCGTGGTCATGG
CCAACTACTCCTGGACGGTAGAGAGTTGTCCCAATTGGGCTCTCAGCGGCGCAGATAATCTCAACGCCTGGCTACAGCCC
CTCTCCGGGGTTCTGTTGCCTGCCGTCGTGTTCTGTCTGTCCATTCCACGTCGTCGAAGGCTCGAAGTGCCGGGCCGATT
GTTTGTCCAAGGTGCTTTAAAGAGATATATGACTCTAGTGTTTGACGCAATAGTCGCTTTTGCCATTGTGACCACCGATA
CTGTCATCTGGCTCAGCATCTGTTTTGCTTTTGCTGGTCCCATGATCATCAGTGGTCTGTACGAGGCCATGCTCGACAAC
TACGTGCTGCGATACCTAACTCGCAAAACACGCAACAGCAGGCTGAGCTTGGATATGCGTTGCCGCTGCCTCATGGTTAT
TCTGATTGGAAACCTGGATCTTGTGTGGAACACCGACATAGAAAACAGCGGTGGCGGTTTCGTCACCGATGGTGCCGACC
GCTCGGACGTTCATTTGAGCAACAACAGATCCGAGATTCCTCTGGGCGAGATTAGATCAAGGAGCTCGTTACTTCCAACA
ATACAACAACCCAATCCCACTGCTGTCGTTCTGGCTTCTCCTTGGATGCACATGGAGCAGTTTCTTTACGACCTTCGTCT
ACACGACGACGACTTTAAATCGAGAGGACATTCACCGCGCCAACATTCTCACGGGGAAGGGGAATTAGGAGCGAAATGTC
TGCTGGGACAGAACTGTCCTGACAAGACCCATTACAAGATGCCGATCCAGCGGACGCCAGATATTCACAGGAAGATTCAT
GACGTCAAAACACAACTAAAGACGATGCTGCTGTGTCAATATTCGTTCGGCTCCATCGTAGGCGCCCCGGTAATGTACGT
TGCTTCGACCGTTTATTGTCATAAATGAGAACAATATTCTAACAAACTTCTAGATTCTATTTAGGGGGCTTCTTGTTCAC
TCTTCTGCAGAGTAGGACCACCCCTGGTGACGAGAGCGCGTCGTACGCTATTTGCCCCTGACTTTACGCTTCAATATACT
CGGTGCTGACAACAGACAGATTGGCGCTGGCCTTTGGTCAATGGTATATGGTATGGACTTGCACACTGCTTTGATCTTCA
GTTTACATGTTGACAAGCCTGTAGACAATCCCTCATATTGCTATCGTCTCCGGCCTTCTGCTAGCCGGAAACAATCCCAA
CATTCTAGAGGGAGTACTTCATATGAACGGCGAGTACGAAGAAGATAACAAGATAGTTCTCGGCTTTAAGTACGGCCTTG
CCTTCCCTTCGTGCTACAAAGTGGCCTGGCTGTGGAATCGCGGCCACAACAAGAAAAACTGGCTCAAAACGCTAGTTGAC
ACTTACTTGAAACAAAAACGGCCCAATTCAAAGGAATTGGACGTCGACGATGACATGCTCCAGCTTCAACAGCGAACGAC
CCTGTCGTTCCTCGACTGGGCTCTTCTTCTTTTCTTGACTATATTACTTCTTAGCCTGCCGTGCGTTCTAGCCCTTCTGA
CAGCATATTTCACACCCGTAGTCGGCGTGTCATGCCGGGCTATCACAATCACAATGTACCTCTCTGCTCAGATTGGTCGT
ACGTTTGTCTACTTTCCTATCATTTCTTTCACTTTCCTTCCGAAATTGACATCTCCAGAAATCATACTCTGGCTGTGGGC
ATATGCCGGTCCGCTAGCTGTGATAGACGTCTATGGTCTAAGCTTTTTCTTCACCGGCGGCTGGTTGGATAGAAACGGCT
TTTATCGTCCGTATGATGTGCGTTGGCTAGCTGGCAACGACGGTTTGGCACACAACCCGATCAAGCTGATGCGCATACTA
TGGAGTAAAGGACGAGGACTTCTTTGCTGGCAGTTTCTATGGAATTGTCTCTACTATCTCGGCCAGTGGTTACTGGGTGG
TTTCGGCGTTCTGGCCGCCATTGGCGGTACCTTGATGCAGCTGATGGGCGTTTACTCGGCCGACGTCTGCCGCGTCACCA
CACCGAACTGGAGTAAAAATGACATTCACCGGGCTGATGTCCTTCTCTCGCAAAACACAGCGAAAATGATTCGCCTCTCC
AGAAGTAGGCCGTGGGCGATTCTTCAGATGTAACTGCTCTATCGATGTTCATTTCTTGCTGACTTTAATAGGCACGTGGA
TACCGTTTGCCTCCACAGCCATTGGCTTTATGAGTGCTGTCAGCTTTGTTGGATGGTTGTATCAGCGTCGTATGCGCAAT
GTTTTCCTAAAATGTAGGTGATTTTCTACTACACCTTACCTTCGATACTAGCCGCCGTAAATGTTGCTAACAGTCGCAGT
GGCCACACGTATCGACGACAACGAGTGTCAAGAAGCCAAGTGGTCCCATCCGGAACCAGCCAAAGCAGAAGAACACAAGG
GTGAAAGCTTTTTGAAGACGCCTGTTGGTGGCGAGACAGAATTACTTCTGCAGGATCTGGAAACAATGGGCGATAGTGGC
AATACTTCTGGAAAGCCTCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62