GenePrediction:GLEAN_5978 Details

Name: GLEAN_5978
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_82:758629..756644 (- strand)
Length: 1986
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_82:758629..758573 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_82:758503..758359 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_82:758296..758146 (- strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_82:758065..757881 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_82:757816..757599 (- strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_82:757538..757149 (- strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_82:757076..756898 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_82:756836..756644 (- strand)
Length: 193
>GLEAN_5978 class=GenePrediction position=GCSC_82:758629..756644 (- strand)
ATGGCCTTTTTGTTGGCGTTGGTTGTCCTTGTGCTTCTTGGCATCCGTGCCGCTGTGGTAAGCTGCATTGAACGGGTATA
GGCTCATTACTCGGTAATTCCTGCTGACAGGCCTTCCACTTTCAAGACTGTCATCCGGGCACACAGCTCATCGCTCTCAC
TGCTCCCCCGCGCAGGCTTACTTGCTCCATATTCGCGGCTACTTTGGGCCTTCCCCCATGAGTACAGGGGTACCATCACC
TTGGATTTACCTAAGCTGCACAAGAAGCTCGGTATGCTACTGCTGCAGCTGCCCGGAAAGCTATAGCTGGCACTTACACG
TATTACACTATAGGACCCCTGATTCATATTGGCCCTGGCGAGGTCTCTTTCTACTCTTTGGAGGCCTATGATGTTGTCCA
CAAGCCGAACGGCGGCTTTGTGAAAGATCCCAGAACTTACGGCCAGTTTGTTCAGGATGGCCATCCGGCCTTATTTTCTA
TCACGTATGAGATCCCGTCCTCTCCCCCGGTTTTGTGCCAGCGATGCGTCTAACATTCGGTCTCACTTCCGCCTTAGTAC
TAAGCCTGCCGGAAGAGCATGCAAAGCGCCGTCGCATGATGGGCCAACTTCTTAGCCGAAGCAAGGTTCCAACTCTCGAG
GGCCTGATGCTGCATCACATAGATGCCTTTGTCCATGCCCTACGTAGACGGAGCGGCACCTTGGTCGAAGCCGGCTCAGC
ATGTCGAGCGCTCGAGGCTGACATTATATGTAAGCAGGCAATCCGACCTCGGCTACCCTTCGTGACTGATAATGGTTCGG
ACACGCAATATAGCAACATTCTCATTTGGCGAGTCCCTGGGCGCGGTAGATGCCTGGGAGAGGGGCCAGAACGTGAAAAT
GGTACAGGCAAATGACGAAAAGGCAACCTGGATGCCCCTACTGACGAGCTTTCCTCTGCTCTGCGACCTGTGGGACAGAG
TCCAGCGTACCGTTGCGAGGACGACAGGCATACAGTCCGTATACTGCAAAGCTCTCGAAGAATTTGATCAGGTGCGTCTG
TGTTCATTTTAGGATATATTTGCCAATGTTGTTTCTAACCTCAAGTTGTAGTGGGCTGAGAAGTCATGGATGAGGGCAAC
GTCTGAAGGAGAGCCATCCGGATTTCCAAATCTCATCAAGGTGTTGACCAGGTCTGGACTGCCAGCTGAGACGGCACTGT
CCGAAGCCAAAGAAAACCTGGGCCCCGGCACGGACACGACATCTGGCTCTCTCGCTCACATCCTGTACGCGCTGTCCAAA
AACAAGGCCTACCAGGAAACTCTCTTCCTCGACCTGGCCCAAGCTGGCTTCCCAACAAACATGACGGCCCTCGAAGGAGT
GCCGAGACTGAAGGCCTGTGTGAAAGAGGGGATTCGCTGGGCCGGCACAGCTGCCGCGATGCTGCCGCGCATTGTTCCAC
CAGAAGGTGTAGATCTGCACGGCTGCTATATTCCAGCGGGGGTGAGTCTCGTTTCCAGAATGTTCCTTGTATCGAGCAAT
GCACCAGAAGCTCACATAACCCAAATTTCAAAGACAGTCCTGACTTCGTCCCCCATCTGGTATCTCCGGGACGAGGCTGC
GTTTCCACAACCGGAGCTGTTCGACCCGTATCGTTGGATCTCCACGGACGGGACGAACCCTACTGAAAACCGCTTGCGAG
ACCGATACTACATTCCGTTCTCCAAAGGGCTGAACATCTGCATAGGAGCTCAGTAAGTCCAGCCGCTAGTTTGTACTTTG
GAAGGACCTTTGAGTGTCTGATACCGTGGCCAGATTTGCATACTATGAGCTATATCTAAGCGTGGCAAAAGTGCTGCGTA
ACTATCGCCTGCGATCACCAAGTGACCAGCATAATGTTGGTGTCGGCGAAAAGGGCTGGCAGTCTGTCCCACTGCCCCTG
CGGAAAGAATGGGTTGCCGCCGTTCCACTGCAGGCTCTCGACATTATTCTTGAGCCGAGATTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62